Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 10, Number 4—April 2004

Research

Ixodid and Argasid Tick Species and West Nile Virus

Charles Henderson Lawrie*Comments to Author , Nathalie Yumari Uzcátegui*, Ernest Andrew Gould*, and Patricia Anne Nuttall*
Author affiliations: *Centre for Ecology & Hydrology, Oxford, United Kingdom

Main Article

Table 2

Nucleotide sequences of primers used in first round (5′[1] and 3′[2]) and second round (5′[2] and 3′[2]) of nested RT-PCRa

Primer Sequence Position in WNV (NY99)b
5′(1)
CCATATGAATTCCATGAGTGCTATCAATCGGCGGAG
31 aa upstream (C gene) from start of PrM gene (373)
3′(1)
CATATGCGGCCGCTTACTAGGTGATTGATCTGTTGTTCTCC
31 aa downstream (NS1) from end of E gene (2,562)
5′(2)
CATATGCGGCCGCTTACTACCGGTCCATCCAAGCCTC
Start of E gene (967)
3′(2) CCATATAGATCTCGGAGGTCATTCAACTGCCTTGGAATGAGC 395 aa into E gene (2,152)

aRT-PCR, reverse transcriptase–polymerase chain reaction; aa, amino acids.
bNucleotide position in relation to complete genome sequence of WNV (NY99) shown in parentheses (accession no. AF19685).

Main Article

TOP