Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 10, Number 5—May 2004

Research

Acute Tick-borne Rickettsiosis Caused by Rickettsia heilongjiangensis in the Russian Far East

Oleg Y. Mediannikov*†‡Comments to Author , Yuri Sidelnikov†, Leonid Ivanov§, Eugenia Mokretsova†, Pierre-Edouard Fournier‡, Irina Tarasevich*, and Didier Raoult‡
Author affiliations: *Gamaleya Research Institute of Epidemiology and Microbiology, Moscow, Russia; †Far Eastern State Medical University, Khabarovsk, Russia; ‡Université de la Méditerranée, Marseille, France; §Khabarovsk Plague Control Station of Ministry of Health of Russian Federation, Khabarovsk, Russia

Main Article

Table 1

List of the primers used to detect rickettsial DNAa

Gene for amplification Primer name Primer sequence 5´-3´a Annealing temperature
gltA CS1d ATGACTAATGGCAATAATAA
CS2d ATGACCAATGAAAATAATAAT 50°C
CSEndr CTTATACTCTCTATGTACA
RpCS877p GGGGACCTGCTCACGGCGG 54°C
RpCS1258n ATTGCAAAAAGTACAGTGAACA
ompA, 5´- portion 190-70 ATGGCGAATATTTCTCCAAAA 53°C
190-701 GTTCCGTTAATGGCAGCATCT
ompA, 3´- portion 190-3588f AACAGTGAATGTAGGAGCAG 46°C for the first round
50°C for the nested and heminested rounds
190-3968r TAGCAGCTGATTTAGTAGCT
190-4084f CATCACCGATATTTCTAGC
190-4338f TTCAGGAAACGACCGTACG
190-4406r ACTATACCCTCATCGTCATT
190-4859f GCGAAATCCAAGGTACAGG
190-5044r AACTTGTAGCACCTGCCGT
190-5125f GCGGTTACTTTAGCCAAAGG
190-5238r ACTATTAAAGGCTAGGCTATT
190-5768f CACCGCTACAGGAAGCAGAT
190-5831r GTGTCGCTAGGTTTTACAAC
190-6228f CGTTGAAGTATAGCATC
190-6427r ATCTAAGCCCAGCTAGCGGT
190-6808r CACGAACTTTCACACTACC
ompB
120-M36
TTCTACAGCTACCATAGTAGCCA
50°C
120-607 AATATCGGTGACGGTCAAGG
120-807 CCTTTTAGATTACCGCCTAA
120-1378 TAAACTTGCTGACGGTACAG
120-1497 CCTATATCGCCGGTAATT
120-2113 CGATGCTAACGTAGGTTCTT
120-2339 CTTGTTTGTTTAATGTTACGGT
120-2778 AAACAATAATCAAGGTACTGT
120-2988 CCGGCTATACCGCCTGTAGT
120-3462 CCACAGGAACTACAACCATT
120-3599 TACTTCCGGTTACAGCAAAGT
120-4232 GGTTTCTCATTCTCTCTATATGG
120-4346 CGAAGAAGTAACGCTGACTT
120-4879 TTAGAAGTTTACACGGACTTTT

aDifferences between primers CS1d and CS2d are indicated by bold letters.

Main Article

TOP