Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 10, Number 5—May 2004

Research

Endemic Venezuelan Equine Encephalitis in Northern Peru

Patricia V. Aguilar*, Ivorlyne P. Greene*, Lark L. Coffey*, Gladys Medina*1, Abelardo C. Moncayo*2, Michael Anishchenko*, George V. Ludwig†, Michael J. Turell‡, Monica L. O’Guinn‡, John Lee‡, Robert B. Tesh*, Douglas M. Watts†, Kevin L. Russell†, Christine Hice*, Stephen Yanoviak*, Amy C. Morrison§, Terry A. Klein‡, David J. Dohm‡, Hilda Guzman*, Amelia P.A. Travassos da Rosa*, Carolina Guevara†, Tadeusz Kochel†, James Olson†, Cesar Cabezas¶, and Scott C. Weaver*Comments to Author 
Author affiliations: *University of Texas Medical Branch, Galveston, Texas, USA; †Naval Medical Research Center Detachment, Lima, Peru; ‡U.S. Army Medical Research Institute of Infectious Diseases, Fort Detrick, Maryland, USA; §University of California, Davis, California, USA; ¶Instituto Nacional de Salud, Lima, Peru

Main Article

Table 3

Oligonucleotides used for polymerase chain reaction amplification and sequencing analysis

Primer (genetic sense) Sequence (5′→3′)
V8369(+) GAGAACTGCGAGCAATGGTCA
V9207B(-) TRCACTGGCTGAACTGTT
V9257B(-)
V8659(+) TACACCCAYTTRTCRTTCTG
AATTGAGGCAGTGAAGAGCGAC
V8953(-) CTGCCTACAGGATTAAAT
E/V 7514(+) ACYCTCTACGGCTRACCTRA
VIIID 10471(-)
α10247A(+) CCTTCCGGTCGAACGGGGTCC
TACCCNTTYATGTGGG
Mlu-T25 (-) TTACGAATTCACGCGTTTTTTTTTTTTTTTTTTTTTTTTT

Main Article

1Current affiliation is Instituto Venezolano de Investigaciones Científicas, Caracas, Venezuela.

2Current affiliation is Department of Biological Sciences, Ohio Northern University, Ada, Ohio.

TOP