Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 10, Number 7—July 2004

Research

Molecular Analysis of Plasmodium ovale Variants

Thin Thida Win*, Amadu Jalloh*, Indah Setyawati Tantular†, Takafumi Tsuboi‡, Marcelo Urbano Ferreira§, Masatsugu Kimura¶, and Fumihiko Kawamoto*Comments to Author 
Author affiliations: *Nagoya University Graduate School of Medicine, Nagoya, Japan; †Airlangga University, Surabaya, Indonesia; ‡Ehime University, Matsuyama, Ehime, Japan; §University of São Paulo, São Paulo, Brazil; ¶Osaka City University Medical School, Osaka, Japan

Main Article

Table 1

Oligonucleotide primers used in this study

Target gene
Primers
Sequences (5′→3′)
A type of the SSUrRNA gene 18S F AACCTGGTTGATCTTGCCAGTAGTC
18S F1 CGATTCGGAGAGGGAGCCTGA
PoR2 TGAAGGAAGCAATCTAAGAAATTT
P1F-UP TCCATTAATCAAGAACGAAAGTTAAG
18S F2 TGGATGGTGATGCATGGCCGT
18S R TAATGATCCTTCCGCAGGTTCACC
Cytochrome b gene Cyt b 1F ATGAATTATTATTCTATTAATTTAG
Cyt b 1R GGATCACTTACAGTATATCCTCC
Cyt b 2F CAAATGAGTTATTGGGGTGCAAC
Cyt b 2R TTTTAACATTGCATAAAATGGTA
Cyt b 3F CCAAATCTATTAAGTCTTGATGT
Cyt b 3R TGTTTGCTTGGGAGCTGTAATCA
Cysteine protease gene CysP-F GCCAGTGTAGGTAATATTGAAT
CysP-R GTATAAAATATCATCATCATCA
Ookinete surface protein genes
First polymerase chain reaction (PCR)
Pos 25 Po8F2 CTTTTGTTAGTATTTCCTCC
Po8R1C ACATTGAACACAGAATATGC
Pos 28-1 Po1F1 TCCCCTTTTGTCCGTTTGTC
Po1R1 AAAGACTGCTACACGCATAC
Pos 28-2 Po4NF1 GTTCATTACATTAAGTTCTC
Po4R1 TTAAATTGTATAAATTACACTG
Nested PCR
Pos 25 Po8F1-in TTACAGTTTGTTTCTCGTC
Po8R1-in AGGTTTAAGACATTGAACAC
Pos 28-1 Po1F1-in TTTTCTTTTCGTTTGCTTGC
Po1R1-in TCAATATGGACACAGAATGC
Pos 28-2 Po4F1-in TTTACCATTTTCCAATATGC
Po4R1-in CAATTAAAATTAAAATTCTG

Main Article

TOP