Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 10, Number 9—September 2004

Typing of Borrelia Relapsing Fever Group Strains

Jonas Bunikis*Comments to Author , Jean Tsao†‡1, Ulf Garpmo§1, Johan Berglund§, Durland Fish†, and Alan G. Barbour*
Author affiliations: *University of California—Irvine, Irvine, California, USA; †Yale University School of Medicine, New Haven, Connecticut, USA; ‡Michigan State University, East Lansing, Michigan, USA; §Kalmar County Hospital, Kalmar, Sweden; 1These two authors contributed equally to the study.

Main Article

Descriptive statistics for IGSa and p66 loci of three Borrelia species

Species Locus No. samples No. variants Aligned characters
π b
Base pairs No. gapped Polymorphisms (%)
Borrelia miyamotoi s.l. IGS 33 4 474 15c 40 (8.4) 0.058
p66 d 19 3 617 9 38 (6.2) 0.042
B. lonestari IGS 20 3 412 1 14 (3.4) 0.023
p66 e 7 3 346 0 5 (1.4) 0.010
B. hermsii IGS 9 4 665 2 20 (3.0) 0.015
p66 e 5 3 516 3 8 (1.6) 0.010

a IGS, 16S-23S rRNA gene intergenic spacer region.
b π, mean nucleotide diversity at each aligned position.
c Excludes an 81-bp indel.
d Partial p66 genes were amplified by nested PCR with outer forward and reverse primers of 5′GATTTTTCTATATTTGGACACAT and 5′AATTTAATCAGATTGTTTAGCTCTA and inner primers of 5′GACACATATCTAAAAAAGCAAACAC and 5′CTAATCCGGTTTTTACGTATATGC and following conditions: 40 cycles of 94°C for 60 s, 55°C for 120 s, and 74°C for 120 s. GenBank accession numbers for p66 genotypes are the following: B. miyamotoi s.l. type 1 (AY363722), type 2 (AY363723), type 3 (AY363724); B. lonestari type 1 (AY363689), type 2 (AY363690), type 3 (AY363691); B. hermsii type 1 (AF016408), type 2 (AF228028), and type 4 (AF116905).
e Analysis of B. lonestari and B. hermsii p66 fragments was limited to 346 of 605 bp and 516 of 608 bp, respectively, which corresponded to the shortest sequences available for all types of the individual species.

Main Article