Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 11, Number 1—January 2005

Research

Genetic Background of Escherichia coli and Extended-spectrum β-Lactamase Type

Author affiliations: *Hôpital Louis Mourier, AP-HP, Colombes, France; †INSERM E0339, Paris, France; ‡Hôpital Nord, Amiens, France; §Hôpital Tenon, Paris, France; ¶Hôpital Trousseau, Paris, France; #Hôpital Morvan, Brest, France

Main Article

Table 1

Sequence of primers used to detect bla genes*

PCR target Primer name Primer sequence Reference or accession no.
blaTEM A
B ATGAGTATTCAATTCCG
CTGACAGTTACCAATGCTTA (22)
blaSVH P4
P5 GGTTATGCGTTATATTCGCC
TTAGCGTTGCCAGTGCTC (22)
blaCTX-M (CTX-M-1 cluster) MenA
MenB AAGACTGGGTGTGGCATTGA
AGGCTGGGTGAAGTAAGTGA X92506
blaCTX-M (CTX-M-2 cluster) M2A
M2B CTGGAAGCCCTGGAGAAAAG
TACCTCGCTCCATTTATTGC X92507
blaCTX-M (CTX-M-9 cluster) ToA
ToB GCTTTATGCGCAGACGAGTG
GCCAGATCACCGCAATATCA AF174129
blaCTX-M (CTX-M-8 cluster) A8
B8 GCCTGTATTTCGCTGTTG
TGTCATTCGTCGTACCATAA AF189721

*PCR, polymerase chain reaction.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO