Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 11, Number 10—October 2005


Detecting Biological Warfare Agents

Linan Song*, Soohyoun Ahn*, and David R. Walt*Comments to Author 
Author affiliations: *Tufts University, Medford, Massachusetts, USA

Main Article

Table A1

Sequence information of probes and primer pairs* (Download PDF [47 KB, 1 page])

Organism Target gene Accession no. Probe sequences and primer sequences (5’-3’) PCR product (bp) Name
Brucella melitensis Sequence between BMEI1658 and BMEI1659† AE009601 P: 5´-AGGTGTCATTAGGCTTGCTTGTGGACGAGAGAACGGTGGACCAAGGGAGA-3´
Clostridium botulinum Random chromosomal DNA fragment‡ NA P: 5´- CATCTTCACGGAGGTGAACAAGCCTCCATGTTCGACGGTAACCCAGAAGC-3´

*P, probe; F, forward primer; R, reverse primer; NA, not applicable. All sequences were purchased from Integrated DNA Technologies, Inc. (Coralville, IA, USA). Probe sequences were modified with an amine group and C6 linker at the 5´ position, and these were used to immobilize the probe on microspheres. Synthetic complementary targets of probes and reverse primers were modified with Cy3 at 5´ position as a reporter for array hybridization.
†Sequences are from the noncoding region between 2 open reading frames, BMEI1658 and BMEI1659.
‡Sequences were obtained by sequencing by the collaborator and are not available from GenBank.

Main Article