Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 11, Number 10—October 2005

Dispatch

Detecting Biological Warfare Agents

Linan Song*, Soohyoun Ahn*, and David R. Walt*Comments to Author 
Author affiliations: *Tufts University, Medford, Massachusetts, USA

Main Article

Table A1

Sequence information of probes and primer pairs* (Download PDF [47 KB, 1 page])

Organism Target gene Accession no. Probe sequences and primer sequences (5’-3’) PCR product (bp) Name
Bacillus anthracis capA M24150 P: 5´-CCGAGTCCTAGACAGGAAGCCTTAGCAAAAGCAATGGTTGATGCAGGGGC-3´
F: 5´-GGGGGGAAGAATACGATAAT-3´; R: 5´-GTTCTTGTCCATCCTTGGTC-3’ 188 BA1
P: 5´-ACGCACTGGGGGGAAGAATACGATAATAAACCGAGTCCTAGACAGGAAGC-3´
F: 5´-TAGTAAATACGCACTGGGTT-3´; R: 5’-CATCCTTGGTCAAACACAAA-3´ 194 BA2
pagA M22589 P: 5´-GGAAGAGTGAGGGTGGATACAGGCTCGAACTGGAGTGAAGTGTTACCGCA-3´
F: 5´-AAAATGGAAGAGTGAGGGTG-3´; R: 5´-CCGCCTTTCTACCAGATTTA-3´ 120 BA3
P: 5´-TGTATCACCAGAGGCAAGACACCCCCTTGTGGCAGCTTATCCGATTGTAC-3´
F: 5´-TGTATCACCAGAGGCAAGAC-3´; R: 5´-TTCTGTGTGGATTGATCCTC-3´ 106 BA4
SASP-B AF359938 P: 5´-GAAGCTAAGAAAGCGCAAGCTTCTGGTGCTAGATTCAAAGCACAAATGC-3´
F: 5´-GTAAAACAAGCAAACGCACA-3´; R: 5´-GATTGTGATTGTTTTGCAGC-3´ 162 BA5
P: 5´-CAAGCAGTAAAACAAGCAAACGCACAATCAGAAGCTAAGAAAGCGCAAGC-3´
F: 5´-TTTGCGACTGAAACAAATGT-3´; R: 5´-ATGCACGTCTGTTTCAGTTG-3´ 142 BA6
Brucella melitensis Sequence between BMEI1658 and BMEI1659† AE009601 P: 5´-AGGTGTCATTAGGCTTGCTTGTGGACGAGAGAACGGTGGACCAAGGGAGA-3´
F: 5´-TCCGAGGGTAAACACCTAAG-3´; R: 5´-ACTCACGGACAGCATTAGGT-3´ 181 BM1
P: 5´-CTCTCACGGTCCCCATAATGGAGAGTGATCCGAGGGTAAACACCTAAGGG-3´
F: 5´-TCTCTCACGGTCCCCATAAT-3´; R: 5´-AGCAAGCCTAATGACACCTT-3´ 147 BM2
Clostridium botulinum Random chromosomal DNA fragment‡ NA P: 5´- CATCTTCACGGAGGTGAACAAGCCTCCATGTTCGACGGTAACCCAGAAGC-3´
F: 5´-AGATCAGAAGGATGTACCGC-3´; R: 5´-ACTCTTGGACATTGGGGTAA-3´ 173 CB1
P: 5´-CCACCGGGAGTGCCGGAAGATCAGAAGGATGTACCGCTAGTAACTCATCT-3´
F: 5´-AATAATACGCCTATGACGCC-3´; R: 5´-TAAACCTTTTGCTGTCCACC-3´ 163 CB2
Yersinia pestis Plasminogen activator M27820 P: 5´-GGACGTCTCTGGCTTCCGGGTCAGGTAATATGGATGACTACGACTGGATG-3´
F: 5´-CAAAAATGTCGCTATCCTGA-3´; R: 5´-GGTCATATTCATTGGCATGA-3´ 201 YP1
P: 5´-TCCATACTCATTTCTGACCCTGAATGCCAGGGGGTGGACGTCTCTGGCTT-3´
F: 5´-ACGCAGAAACAGGAAGAAAG-3´; R: 5´-CATCCAGTCGTAGTCATCCA-3´ 168 YP2
Bacillus thuringiensis kurstaki cry1A AY225453 P: 5´-TGGTCAGGGCATCAAATAATGGCTTCTCCTGTCGGTTTTTCGGGGCCAGA-3’
F: 5´-TATTATTGGTCAGGGCATCA-3´; R: 5´-GTTCTATACACGCCCTGACC-3´ 144 BTK1
P: 5´-GGTAGTTTTCGAGGCTCGGCTCAGGGCATAGAAAGAAGTATTAGGAGTCC-3´
F: 5´-TGATGGTAGTTTTCGAGGCT-3´; R: 5´-CGACAGGAGAAGCCATTATT-3´ 153 BTK2
Vaccinia virus Thymidine kinase U94848 P: 5´-CGTATGGCAAACGAAGGAAAAATAGTTATAGTAGCCGCACTCGATGGGAC-3´
F: 5´-ATTCTGTGAGCGTATGGCAA-3´; R: 5´-TCTATCTCGGTTTCCTCACC-3´ 199 VA1
P: 5´-GGCGGACATATTCAGTTGATAATCGGCCCCATGTTTTCAGGTAAAAGTAC-3´
F: 5´-GGCGGACATATTCAGTTGAT-3´; R: 5´-GCTTCCAATGCTTCAAAATT-3´ 183 VA2
Francisella tularensis fopA AF097542 P: 5´-GGTTCAGCTACAGCATCTATCGCTGCAGGTTCAGATAATATCGATACATC-3´
F: 5´-TTAGGTTCAGCTACAGCATC-3´; R: 5´-TGTCCTTGTTAGTCAAAGCG-3´ 155 FT1
P: 5´-CATCAGCAAACACTAATTCAGCTACTACACAAAGCAGTGGTTTTGCAGCT-3´
F: 5´-TCAGCTACAGCATCTATCGC-3´; R: 5’-TGTCCTTGTTAGTCAAAGCG-3’ 149 FT2

*P, probe; F, forward primer; R, reverse primer; NA, not applicable. All sequences were purchased from Integrated DNA Technologies, Inc. (Coralville, IA, USA). Probe sequences were modified with an amine group and C6 linker at the 5´ position, and these were used to immobilize the probe on microspheres. Synthetic complementary targets of probes and reverse primers were modified with Cy3 at 5´ position as a reporter for array hybridization.
†Sequences are from the noncoding region between 2 open reading frames, BMEI1658 and BMEI1659.
‡Sequences were obtained by sequencing by the collaborator and are not available from GenBank.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO