Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 11, Number 2—February 2005


Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens

Thomas Briese*1, Gustavo Palacios*1, Mark Kokoris†1, Omar Jabado*, Zhiqiang Liu*, Neil Renwick*, Vishal Kapoor*, Inmaculada Casas‡, Francisco Pozo‡, Ron Limberger§, Pilar Perez-Brena‡, Jingyue Ju*, and W. Ian Lipkin*Comments to Author 
Author affiliations: *Columbia University, New York, New York, USA; †Qiagen Inc., Valencia, California, USA; ‡Instituto de Salud Carlos III, Majadahonda, Madrid, Spain; §New York State Department of Health, Albany, New York, USA

Main Article

Table A1

Respiratory panel Mass Tag primers.

Target – Masscode FWD/REV Name FWD Sequence Name REV Sequence Ref.
FLUBV 698/598
HCoV-OC43 686/548

RSV B 483/479
HMPV-2 718/654

HPIV 4B 622/606

Legionella pneumophila 678/582 LegPneu-U149 GCATWGATGTTARTCCGGAAGCA LegPneu-L223 CGGTTAAAGCCAATTGAGCG

Main Article

1These authors contributed equally to this study.