Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 11, Number 3—March 2005

Dispatch

Identifying Relapsing Fever Borrelia, Senegal

Hamoud Brahim*, Jean David Perrier-Gros-Claude*, Danielle Postic†, Guy Baranton†, and Ronan Jambou*Comments to Author 
Author affiliations: *Institut Pasteur, Dakar, Senegal; †Institut Pasteur, Paris, France

Main Article

Table

Primers used for amplification of the Borrelia 16S ribosomal RNA gene based on GenBank accession no. M88329 for Crocidurae

Primer (reference) Sequence Tm, °C* Nucleotide position
Fd3 (4) AGAGTTTGATCCTGGCTTAG 58 8–27
T50 (4) GTTACGACTTCACCCCCCT 60 1478–1499
Rec4 (4) ATGCTAGAAACTGCATGA 50 659–675
Rec9 (4) TCGTCTGAGTCCCCATCT 56 1191–1174
Fd4 GGCTTAGAACTAACGCTGGCAG 68 21–42
595R CTTGCATATCCGCCTACTCA 60 621–602
500R (4) CTGCTGGCACGTAATTAGCC 64 548–529
BcroF CGTCTTAAGCATGCAAGTCAG 62 45–65 (U42283)
BdutF CGTCTTAAGCATGCAAGTCAA 60 45–65 (AF107364)
BrecF GAAAGGAAGCCTTTAAAGCTTT 60 193–214 (AF10362)
255R
CCCTACCAACTAGCTAATAAGACGC
74
255–231
*Tm, melting temperature.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO