Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 11, Number 5—May 2005


Highly Pathogenic H5N1 Influenza Virus in Smuggled Thai Eagles, Belgium

Steven Van Borm*Comments to Author , Isabelle Thomas†, Germaine Hanquet†, Bénédicte Lambrecht*, Marc Boschmans*, Gérald Dupont†, Mireille Decaestecker*, René Snacken†, and Thierry van den Berg*
Author affiliations: *Veterinary and Agrochemical Research Centre, Brussels, Belgium; †Scientific Institute of Public Health, Brussels, Belgium

Main Article


Primers used for human (h) and avian (a) diagnosis, subtyping, and sequencing

Primer Specificity Host Primer sequence (5´–3´) PCR product (bp) Reference*
H5-155F Flu A/H5 h, a ACACATGCYCARGACATACT 545 (6)
H5 1 F Flu A/H5 h GCCATTCCACAACATACACCC 401 Mod. from (8)
β act 5 βactine h AACACCCCAGCCATGTAC 181 This study (IT)
β act 6 βactine h GTAGTCAGTCAGGTCCCG This study (IT)
β act 7 βactine h AACACCCCAGCCATGTAC 144 This study (IT)
β act 8 βactine h GCCAGCCAGGTCCAGACG This study (IT)
18S-F908 18S a AGCGAAAGCATTTGCCAAGA 401 This study (SVB)
H5-614F HA sequencing a GARGAYCTTYTRRTAHTRTGG 645 This study (MB)
H5-1259R HA sequencing a CYTCRAAHTGRGTGTTCATT This study (MB)

*IT, Isabelle Thomas; SVB, Steven Van Borm; MB, Marc Boschmans; Mod., modeled.

Main Article