Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 11, Number 5—May 2005

Dispatch

Highly Pathogenic H5N1 Influenza Virus in Smuggled Thai Eagles, Belgium

Steven Van Borm*Comments to Author , Isabelle Thomas†, Germaine Hanquet†, Bénédicte Lambrecht*, Marc Boschmans*, Gérald Dupont†, Mireille Decaestecker*, René Snacken†, and Thierry van den Berg*
Author affiliations: *Veterinary and Agrochemical Research Centre, Brussels, Belgium; †Scientific Institute of Public Health, Brussels, Belgium

Main Article

Table

Primers used for human (h) and avian (a) diagnosis, subtyping, and sequencing

Primer Specificity Host Primer sequence (5´–3´) PCR product (bp) Reference*
NP1200F Flu A h, a CAGRTACTGGGCHATAAGRAC 330 (6)
NP1529R Flu A h, a GCATTGTCTCCGAAGAAATAAG (6)
NP 1222 F Flu A h CAGRAGYGGAGGRAAYACYAAYC 245 This study (IT)
NP 1467 R Flu A h CGGGYTCGYTGCCTTYTCGTC This study (IT)
BHAA Flu B h GTGACTGGTGTGATACCACT 900 (7)
BHAD2 Flu B h TGTTTTCACCATATTGGGGC (7)
BHAB Flu B h CATTTTGCAAATCTCAAAGG 767 (7)
BHAC2 Flu B h TGGAGGCAATCTGCTTCACC (7)
H5-155F Flu A/H5 h, a ACACATGCYCARGACATACT 545 (6)
H5-699R Flu A/H5 h, a CTYTGRTTYAGTGTTGATGT (6)
H5 1 F Flu A/H5 h GCCATTCCACAACATACACCC 401 Mod. from (8)
H5 2 R Flu A/H5 h TTAATTCTCTATCCTCCTTTCCAA Mod. from (8)
H5 IS 1F Flu A/H5 h CTTGCGACTGGGCTCAGAAAT 645 This study (IT)
H5 IS 2R Flu A/H5 h CCTTCCAACGGCCTCAAACTG This study (IT)
β act 5 βactine h AACACCCCAGCCATGTAC 181 This study (IT)
β act 6 βactine h GTAGTCAGTCAGGTCCCG This study (IT)
β act 7 βactine h AACACCCCAGCCATGTAC 144 This study (IT)
β act 8 βactine h GCCAGCCAGGTCCAGACG This study (IT)
18S-F908 18S a AGCGAAAGCATTTGCCAAGA 401 This study (SVB)
18S-R1309 18S a AGTCTCGTTCGTTATCGGAATT This study (SVB)
H5-614F HA sequencing a GARGAYCTTYTRRTAHTRTGG 645 This study (MB)
H5-1259R HA sequencing a CYTCRAAHTGRGTGTTCATT This study (MB)

*IT, Isabelle Thomas; SVB, Steven Van Borm; MB, Marc Boschmans; Mod., modeled.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO