Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 11, Number 8—August 2005

Dispatch

Influenza A H5N1 Detection

Enders K.O. Ng*, Peter K.C. Cheng*, Antia Y.Y. Ng*, T.L. Hoang†, and Wilina W.L. Lim*Comments to Author 
Author affiliations: *Department of Health, Hong Kong Special Administrative Region, China; †National Institute of Hygiene and Epidemiology, Hanoi, Vietnam

Main Article

Table 1

Primers and dual-labeled fluorescent probes of the H5 real-time reverse transcription–polymerase chain reaction assay

Primer/probe Target Primer/probe sequence (5´ to 3´) Nucleotide position*
H5-1F TGCCGGAATGGTCTTACATAGTG 266–288
H5-1R HA† gene TCTTCATAGTCATTGAAATCCCCTG 347–323
H5-1P f†-AGAAGGCCAATCCAGTCAATGACCTCTGTTA-xp† 290–320
H5-2F GTGGCGAGCTCCCTAGCA 1615–1632
H5-2R HA gene TCTGCATTGTAACGACCCATTG 1695–1674
H5-2P f-TGGCAATCATGGTAGCTGGTCTATCCTTATGG-xp 1634–1665

*Based on some of the Vietnam H5N1 strains (e.g., A/Viet Nam/1194/2004).
†HA, hemagglutinin; f, 6-carboxyfluorescein; xp, carboxytetramethylrhodamine.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO