Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 11, Number 8—August 2005


Coxiella burnetii Genotyping

Olga Glazunova*1, Véronique Roux*1, Olga Freylikman*†, Zuzana Sekeyova*‡, Ghislain Fournous*, Judith Tyczka§, Nikolai Tokarevich†, Elena Kovacova‡, Thomas J. Marrie¶, and Didier Raoult*Comments to Author 
Author affiliations: *Unité des Rickettsies, Marseille, France; †Pasteur Institute of Epidemiology and Microbiology, Saint Petersburg, Russia; ‡Institute of Virology SAS, Bratislava, Slovak Republic; §University of Giessen, Giessen, Germany; ¶University of Alberta Department of Medicine, Edmonton, Alberta, Canada

Main Article

Table 1

Primers used for PCR amplification and sequencing of Coxiella burnetii gene spacers

Spacer name ORF Nucleotide sequence (5´–3´)* Amplified fragment length (bp)
Cox2 Hypothetical protein Cox20766 CAACCCTGAATACCCAAGGA 397
Hypothetical protein Cox21004 GAAGCTTCTGATAGGCGGGA
Cox5 Sulfatase domain protein Cox77554 CAGGAGCAAGCTTGAATGCG 395
Entericidin, putative Cox77808 TGGTATGACAACCCGTCATG
Cox18 Ribonuclease H Cox283060 CGCAGACGAATTAGCCAATC 557
DNA polymerase III, epsilon subunit Cox283490 TTCGATGATCCGATGGCCTT
Cox20 Hypothetical protein Cox365301 GATATTTATCAGCGTCAAAGCAA 631
Hypothetical protein Cox365803 TCTATTATTGCAATGCAAGTGG
Cox22 Hypothetical protein Cox378718 GGGAATAAGAGAGTTAGCTCA 383
Amino acid permease family protein Cox378965 CGCAAATTTCGGCACAGACC
Cox37 Hypothetical protein Cox657471 GGCTTGTCTGGTGTAACTGT 463
Hypothetical protein Cox657794 ATTCCGGGACCTTCGTTAAC
Cox51 Replicative DNA helicase, intein-containing Cox824598 TAACGCCCGAGAGCTCAGAA 674
Conserved hypothetical protein – Uridine kinase Cox825124 GCGAGAACCGAATTGCTATC
Cox56 OmpA-like transmembrane domain protein Cox886418 CCAAGCTCTCTGTGCCCAAT 479
Conserved hypothetical protein Cox886784 ATGCGCCAGAAACGCATAGG
Cox57 Rhodanese-like domain protein Cox892828 TGGAAATGGAAGGCGGATTC 617
Hypothetical protein Cox893316 GGTTGGAAGGCGTAAGCCTTT
Cox 61 Dioxygenase, putative Cox956825 GAAGATAGAGCGGCAAGGAT 611
Hypothetical protein Cox957249 GGGATTTCAACTTCCGATAGA

*The numbers are beginning or end locations of the genes where the primers were chosen.

Main Article

1Dr. Glazunova and Dr. Roux contributed equally to this work.