Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 11, Number 8—August 2005

Research

Coxiella burnetii Genotyping

Olga Glazunova*1, Véronique Roux*1, Olga Freylikman*†, Zuzana Sekeyova*‡, Ghislain Fournous*, Judith Tyczka§, Nikolai Tokarevich†, Elena Kovacova‡, Thomas J. Marrie¶, and Didier Raoult*Comments to Author 
Author affiliations: *Unité des Rickettsies, Marseille, France; †Pasteur Institute of Epidemiology and Microbiology, Saint Petersburg, Russia; ‡Institute of Virology SAS, Bratislava, Slovak Republic; §University of Giessen, Giessen, Germany; ¶University of Alberta Department of Medicine, Edmonton, Alberta, Canada

Main Article

Table A2

Primer used in djlA, com1 and QpH1 and QpRS plasmid targeted sequences for PCR amplification and sequencing

Primer Nucleotide sequence 5´ → 3´ Position in the gene
djlA-1*† CGGTGATGAACTGGATTGG –5 – 15
djlA-2† ATTGACCTGACGCGCTTGACG 266 –247
djlA-3† GGCAACGCAAGACCCCCGTG 579 – 598
djlA-4*† AACCATGCTTCGCACCTTAC 810 –791
com-1*† CGTGAAGAACCGTTTGACTG 3 – 22
com-2† TGAGGATTGCCTGCCACTGG 284 – 265
com-3† GCGCTGCTCAGTGTCGACGG 490 – 509
com-4*† CTTTTCTACCCGGTCGATTTC 759 – 739
Primer Nucleotide sequence 5´ → 3´ Position in the plasmid ORF
QpH11 TGACAAATAGAATTTCTTCATTTTGATG QpH1 (gb:AE016829) 15332 –15359 Spacer between two hypothetical proteins
QpH12 GCTTATTTTCTTCCTCGAATCTATGAAT QpH1 (gb:AE016829) 168348 – 16375 Spacer between two hypothetical proteins
QpRSO1 CTCGTACCCAAAGACTATGAATATATCC QpRS gb:Y15898) 14761 –14734 Hypothetical protein
QpRS02 CACATTGGGTATCGTACTGTCCCT QpRS gb:Y15898) 14398 – 14321 Hypothetical protein
QpDV1f ATGAGAGAAGAGCAGCCGCT QpRS (gb:Y15898) 9889 – 9908 Hypothetical protein
QpDV1r TCAATGATCCGATGTGCGTTT QpH1 (gb:Y15898) 10634 –10614 Hypothetical protein

*Oligonucleotide primer used for PCR amplification.
†Oligonucleotide primer used for sequencing.

Main Article

1Dr. Glazunova and Dr. Roux contributed equally to this work.

TOP