Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 12, Number 2—February 2006

Synopsis

Bartonella quintana Characteristics and Clinical Management

Cédric Foucault*, Philippe Brouqui*, and Didier Raoult*Comments to Author 
Author affiliations: *Université de la Méditerranée, Marseille, France

Main Article

Table A1

Available primers for Bartonella spp. Amplification

Microorganism Gene Direction* Primer Sequence
Bartonella clarridgeiae ribC F PBC5 TACATAACGAGCCAATT
B. clarridgeiae ribC R PBC15 TAGCTTTAGAACAATATGGT
B. henselae ribC F PBH-L1 GATATCGGTTGTGTTGAAGA
B. henselae ribC R PBH-R1 AATAAAAGGTATAAAACGCT
B. bacilliformis ribC F PBH-L1 GATATCGGTTGTGTTGAAGA
B. bacilliformis ribC R PBB-R1 AAAGGCGCTAACTGTTC
B. quintana ribC F PBH-L1 GATATCGGTTGTGTTGAAGA
B. quintana ribC R PBQ-R1 AAAGGGCGTGAATTTTG
All Bartonella ribC F PBH3 CCAAGTGCTACATAACCATC
All Bartonella ribC R PBH4 CGGGTTGTTATTGCTCTTAC
All (except B. bacilliformis) 16s-23s spacer F 16SF AGAGGCAGGCAACCACGGTA
All (except B. bacilliformis) 16s-23s spacer R 23S1 GCCAAGGCATCCACC
All Bartonella 16s-23s spacer F QHVE1 TTCAGATGATGATCCCAA
All Bartonella 16s-23s spacer R QHVE2 TTGGGATCATCATCTGAA
All Bartonella 16s-23s spacer F QHVE3 GATATATTCAGACATGTT
All Bartonella 16s-23s spacer R QHVE4 AACATGTCTGAATATATC
B. bacilliformis 16s-23s spacer F BABF CTGGATCACCTCCTTTCTAA
B. bacilliformis 16s-23s spacer R BABR ATGCCCTTAAGACACTTGAT
B. quintana 16s-23s spacer F BQF CTCCACCATTTTAGGTCATC
B. quintana 16s-23s spacer R BQR GGTTTTGAGAATTCCCTTGC
All Bartonella 16s-23s spacer F 16s1 (C/T)CTTCGTTTCTCTTTCTTCA
All Bartonella 16s-23s spacer R 16s2 GGATAAACCGGAAAACCTTC
All Bartonella 16s-23s spacer F 16s3 (C/T)CTTCGTTTCTCTTTCTTCA
All Bartonella 16s-23s spacer R 16s4 AACCAACTGAGCTACAAGCC
All Bartonella 16s-23s spacer F 16s5 CTCTTTCTTCAGATGATGATCC
All Bartonella 16s-23s spacer R 16s6 AACCAACTGAGCTACAAGCCCT
All Bartonella ribC F BARTON-1F TAACCGATATTGGTTGTGTTGAAG
All Bartonella ribC R BARTON-2R TAAAGCTAGAAAGTCTGGCAACATAACG
All Bartonella 16s S probe ATTTGGTTGGGCACTCTAGGGG
All Bartonella 16s Rp2a ACGGCTACCTTGTTAGGACTT
All Bartonella 16s F 357f TACGGGAGGCAGCAG
All Bartonella 16s R 357ra CTGCTGCCTCCCGTA
All Bartonella 16s F 536F CAGCAGCCGCGGTAATAC
All Bartonella 16s R 536R GTATTACCGCGGCTGCTG
All Bartonella 16s F 800F ATTAGATACCCTGGTAG
All Bartonella 16s R 800R CTACCAGGGTATCTAAT
All Bartonella 16s F 1050F TGTCGTCAGCTCGTG
All Bartonella 16s R 1050R CACGAGCTGACGACA
All Bartonella 35KD F 35KD1fa GTCGCTAAAGGCTGATGA
All Bartonella 35KD R 35KD2ra GACTGATATCGTGCGTGTG
All Bartonella 35KD F 35KDs1f GGTACGACGACAGTAATTGTT
All Bartonella 35KD R 35KDs2r GATTTAAGAGATACCAACCA
All Bartonella PAP F PAP1fa CTTTAATGACGACTTCTGTT
All Bartonella PAP R PAP4ra CCGAAATCTGAGTAACGGTA
All Bartonella PAP R PAP2r CCCTAAATGTTTCAAGTTCA
All Bartonella PAP F PAP3f GCTGACAGAGAAGACGCAA
All Bartonella groEL F BbHs233.p CGTGAAGTTGCCTCAAAAACC
All Bartonella groEL R BbHs1630.n AATCCATTCCGCCCATTC
All Bartonella rpoB F QVE1 TTCAGATGATGATCCCAAGC
All Bartonella rpoB R QVE3 AACATGTCTGAATATATCTTC
All Bartonella Bfp1 ATTAATCTGCAYCGGCCAGA
All Bartonella Bfp2 ACVGADACACGAATAACACC
All Bartonella Bfs3 TTACAAAAATCYGTTGATAC
All Bartonella Bfs4 GTATCAACRGATTTTTGTAA
All Bartonella ftsZ F BaftsZF GCTAATCGTATTCGCGAAGAA
All Bartonella ftsZ R BaftsZR GCTGGTATTTCCAAYTGATCT
B. henselae, B. clarridgeiae ftsZ BhftsZ 1393.n GCGAACTACGGCTTACTTGC
B. henselae, B. clarridgeiae ftsZ Bh ftsZ 1247.p CGGTTGGAGAGCAGTTTCGTC
B. quintana ftsZ F Bq ftsZseqF GCACATATTCTTGATGAGAT
B. quintana ftsZ R Bq ftsZseqR CCCCTATCATCTCATCAAG
B. bacilliformis ftsZ F Bb ftsZseqF GCGCATGTTCTTAGTGAAAT
B. bacilliformis ftsZ R Bb ftsZseqR CCTGTATACGTGATGCATTT
All Bartonella ftsZ FTS1p GCCTTCTCATCCTCAACTT
All Bartonella ftsZ FTS2p CAGCCTCTTCACGATGTG
All Bartonella pap31 PAPn1 TTCTAGGAGTTGAAACCGAT
All Bartonella pap31 PAPn2 GAAACACCACCAGCAACATA
All Bartonella pap31 PAPns2 GCACCAGACCATTTTTCCTT
All Bartonella pap31 PAPns1 CAGAGAAGACGCAAAAACCT
All Bartonella groEL HSPps1 CAGAAGTTGAAGTGAAAGAAAA
All Bartonella groEL HSPps2 GCNGCTTCTTCACCNGCATT
All Bartonella groEL HSPps4 GCTGGNGGTGTTGCNGTTA
All Bartonella groEL HSPps3 GCTGTNGAAGANGGNATTGT

*F, forward; R, reverse.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO