Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 12, Number 5—May 2006

Dispatch

Heterogeneity among Mycobacterium ulcerans Isolates from Africa

Pieter Stragier*, Anthony Ablordey*, L. Manou Bayonne†, Yatta L. Lugor‡, Ireneaus S. Sindani§, Patrick Suykerbuyk*, Henry Wabinga¶, Wayne M. Meyers#, and Françoise Portaels*Comments to Author 
Author affiliations: *Institute of Tropical Medicine, Antwerp, Belgium; †Centre Hospitalier de Libreville, Libreville, Gabon; ‡Yambio Hospital, Eldoret, Kenya; §World Health Organization South Sudan Office, Gigiri, Nairobi, Kenya; ¶Makerere University, Kampala, Uganda; #Armed Forces Institute of Pathology, Washington, DC, USA

Main Article

Table 2

Primer sequence and location in Mycobacterium ulcerans and amplicon length at loci 1, 6, 9, and 33, resulting from a polymorphism in tandem repeat copy numbers

Locus Primer sequence
Amplicon length
Forward primer (5´–3´) Reverse primer (5´–3´) Location 1 copy 2 copies 3 copies 4 copies
1 GCTGGTTCATGCGTGGAAG GCCCTCGGGAATGTGGTT mu0115C04F 380 433 486 539
6 GACCGTCATGTCGTTCGATCCTAGT GACATCGAAGAGGTGTGCCGTCT mu0019B07G 500 556
9 GCCGAAGCCTTGTTGGACG GGTTTCCCGCAGCATCTCG mu0113D07F 435 488
33 CAAGACTCCCACCGACAGGC CGGATCGGCACGGTTCA mu0043E11R 720 778 836

Main Article

TOP