Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 12, Number 9—September 2006

Dispatch

Eighth Major Clade for Hepatitis Delta Virus

Frédéric Le Gal*1, Elyanne Gault*1, Marie-Pierre Ripault†, Jeanne Serpaggi‡, Jean-Claude Trinchet§, Emmanuel Gordien*, and Paul Dény*Comments to Author 
Author affiliations: *Hôpital Avicenne and EA3406, Université Paris 13, Bobigny, France; †Hôpital Saint-Louis, Assistance Publique - Hôpitaux de Paris, Paris, France; ‡Hôpital Necker, Assistance Publique - Hôpitaux de Paris, Paris, France; §Hôpital Jean Verdier, Assistance Publique - Hôpitaux de Paris, Bondy, France

Main Article

Table 1

Four overlapping regions amplified by reverse transcription–PCR for full-length genome sequence determination

Region* Primer name† Primer position Nucleotide sequence of the primers (5´–3´)
R0
(889–1289) 889s 889–911 CATGCCGACCCGAAGAGGAAAG
1289as 1289–1265 GAAGGAAAGGCCCTCGAGAACAAGA
R´1
(305–1161) 305s 305–328 CTCCAGAGGACCCCTTCAGCGAAC
1161as 1161–1138 CCCGCGGGTTGGGGATGTGAACCC
R´2
(962–331) 962s 962–984 GTACACTCGAGGAGTGGAAGGCG
331as 331–311 TCTGTTCGCTGAAGGGGTCCT
R´3
(120–619) 120s 120–140 GTCCCAAGAGGGCGAGGGGAG
620as 619–600 TCCTGGAGCCGGCAGTCCGG

*Name of the amplified region and position on the genome (according to Wang et al. [10]).
†s, forward primer; as, reverse primer.

Main Article

1These authors contributed equally to this work.

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO