Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 13, Number 4—April 2007


Global Emergence of Trimethoprim/Sulfamethoxazole Resistance in Stenotrophomonas maltophilia Mediated by Acquisition of sul Genes

Mark A. Toleman*, Peter M. Bennett*, David M.C. Bennett*, Ronald N. Jones†, and Timothy R. Walsh*Comments to Author 
Author affiliations: *School of Medicine at Cardiff University, Cardiff, Wales; †The JONES Group/JMI Laboratories, North Liberty, Iowa, USA;

Main Article


Oligonucleotide primers used in this study, Cardiff, 2007

Primer Sequence (5′→3′) GenBank accession no. Target Reference







This study

This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
glmmF ACGGTATTCGTGGCAAAGCC AJ289135 glmM This study

Main Article