Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 13, Number 5—May 2007

Fatal Disseminated Acanthamoeba lenticulata Acanthamebiasis in a Heart Transplant Patient

Stéphane Barete*Comments to Author , Alain Combes†, Johan F. de Jonckheere‡, Annick Datry†, Shaïda Varnous†, Valérie Martinez†, Sara García Ptacek*, Eric Caumes†, Frédérique Capron†, Camille Francès*, Claude Gibert†, and Olivier Chosidow*
Author affiliations: *Hôpital Tenon, Paris, France; †Hôpital Pitié-Salpêtrière, Paris, France; ‡Scientific Institute of Public Health, Brussels, Belgium;

Main Article

rDNA sequences of Acanthamoeba isolate (2/533) from the patient, a keratitis isolate (GAK1), 3 environmental T5 subtypes, and 4 other genotypes from persons with nonkeratitis infections

Genotype (strain) DF3 sequence (5′→3′)*
T5 (GAK1) caaaacaccgccgttaatccttt-----cgggggttaatggttggtgaat
T5 (72/2)† caaaacaccgccgttaatccttt-----cgggggttaatggttggtgaat
T5 (PD2S)‡ caaaacaccgctgttaatccttt-----cgggggttaatagttggtgaat
T5 (FLAIV)§ caaaacaccgccgttaatcctttt-caacgggggttaacggttggtgaat
T4 caaaacacca-Atcggcgcggtcgtccttggcgtcggtccttcacggggccggcgcgagggcggcttagcccggtggcacc
T1 caaaacacca-ccatcaggcagtggggtcgtgcttcgcttttccggcaacggggaagtggaggcggtctcattcccctgatgg
T10 caaaacaccatccatttagcayggtcgttttcaaatattcctttttgcgaaggttgtttgggaacgattcgtcctgatggatc
T12 caaaacacca-ccattaacacgatcgttttttgcaaatatgccacatgcgcaagtgtgtggttgtgtttgaaggaacgatttg

*Sequences differences are shown in boldface.
†Five isolates at European Molecular Biology Laboratory (EMBL).
‡Eight isolates at EMBL.
§One isolate at EMBL.

Main Article