Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 13, Number 5—May 2007

Dispatch

Chikungunya Virus in US Travelers Returning from India, 2006

Robert S. Lanciotti*Comments to Author , Olga L. Kosoy*, Janeen J. Laven*, Amanda J. Panella*, Jason O. Velez*, Amy J. Lambert*, and Grant L. Campbell*

Author affiliation: *Centers for Disease Control and Prevention, Fort Collins, Colorado, USA

Main Article

Table 2

Sensitivity and specificity of chikungunya virus (CHIKV) oligonucleotide primers used in real-time reverse transcription–PCR assay

Primer Genome position* Sequence (5′→3′) Sensitivity† Specificity‡
CHIKV 874
874–894
AAAGGGCAAACTCAGCTTCAC


CHIKV 961
961–942
GCCTGGGCTCATCGTTATTC
0.3
CHIKV
CHIKV 899-FAM§
899–923
CGCTGTGATACAGTGGTTTCGTGTG


CHIKV 6856
6856–6879
TCACTCCCTGTTGGACTTGATAGA


CHIKV 6981
6981–6956
TTGACGAACAGAGTTAGGAACATACC
0.9
CHIKV
CHIKV 6919-FAM 6919–6941 AGGTACGCGCTTCAAGTTCGGCG

*On the basis of CHIKV prototype strain S27, GenBank accession no. NC_004162.
†Absolute no. of PFU detected in triplicate testing.
‡No reactivity was observed with the following viruses: o’nyong nyong, Ross River, Mayaro, Semliki Forest, Sindbis, western
equine encephalitis, eastern equine encephalitis, and Venezuelan equine encephalitis subtypes 1AB, 1C, 1D, and 1E.
§Primer labeled at the 5′ terminus with 5-FAM and 3′ Black Hole Quencher 1 (Operon Biotechnologies Inc., Huntsville, AL, USA).

Main Article

TOP