Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 13, Number 7—July 2007

Dispatch

Virus Detection and Monitoring of Viral Load in Crimean-Congo Hemorrhagic Fever Virus Patients

Roman Wölfel*†, Janusz T. Paweska‡, Nadine Petersen†, Antoinette A. Grobbelaar‡, Patricia A. Leman‡, Roger Hewson§, Marie-Claude Georges-Courbot¶, Anna Papa#, Stephan Günther†, and Christian Drosten†Comments to Author 
Author affiliations: *Bundeswehr Institute of Microbiology, Munich, Germany; †Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany; ‡National Institute for Communicable Diseases, Sandringham, South Africa; §Health Protection Agency, Porton Down, Salisbury, United Kingdom; ¶Institute Pasteur, Lyon, France; #Aristotle University of Thessaloniki, Thessaloniki, Greece;

Main Article

Table

Protocol for real-time reverse transcription–PCR

Oligonucleotide* Purpose, 
concentration in nM Sequence and label (5′→3′) Position
(U88410)†
RWCF Forward primer, 600 CAAGGGGTACCAAGAAAATGAAGAAGGC 1068–1095
RWCR Reverse primer, 600 GCCACAGGGATTGTTCCAAAGCAGAC 1248–1223
SE01 Broad-range probe, 100 FAM-ATCTACATGCACCCTGCTGTGTTGACA-TAMRA 1172–1198
SE03 Additional probe, 100 FAM-ATTTACATGCACCCTGCCGTGCTTACA-TAMRA 1172–1198
SE0A Additional probe, 100 FAM-AGCTTCTTCCCCCACTTCATTGGAGT -TAMRA 1131–1106

*All oligonucleotides were used in an assay with the following protocol: 25-µL reaction volume, 5-µL plasma RNA (QIAamp Viral RNA mini kit; QIAGEN, Valencia, CA, USA), 1× concentration of buffer and enzymes from the OneStep RT-PCR kit (QIAGEN), and 400 µmol dNTP, 800-ng nonacetylated bovine serum albumin (Sigma-Aldrich, Munich, Germany). The cycling parameters followed in a Roche LightCycler 1.2 (Roche, Penzberg, Germany) were as follows: 30 min at 50°C, 15 min at 95°C, 46× 15 s at 94°C, and 30 s at 59°C. Fluorescence acquisition occurred at the 59°C step, wavelength filter F1/F2 mode.
†GenBank accession number.

Main Article

TOP