Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 13, Number 8—August 2007

Dispatch

PCR versus Hybridization for Detecting Virulence Genes of Enterohemorrhagic Escherichia coli

Robert S. Gerrish*, James E. Lee*, June Reed*, Joel Williams*, Larry D. Farrell*, Kathleen M. Spiegel*, Peter P. Sheridan*, and Malcolm S. Shields*Comments to Author 
Author affiliations: *Idaho State University, Pocatello, Idaho, USA;

Main Article

Table

Virulence factor targets and primers, including nucleotide sequences, reference, and PCR conditions*

Primer name Nucleotide sequence (5′→3′) Target (bp) Ref. PCR conditions
Denature Anneal Extension
STX1U GTAACATCGCTCTTGCCACA Stx1 gene (204) This study 95°C, 60 s 53.7°C, 60 s 72°C, 240 s
STX1D CGCTTTGCTGATTTTTCACA
STX2U GTTCCGGAATGCAAATCAGT Stx2 gene (206) This study 95°C, 60 s 53.7°C, 60 s 72°C, 240 s
STX2D CGGCGTCATCGTATACACAG
eae-1 ACGTTGCAGCATGGGTAACTC Intimin (818) (8) 95°C, 60 s 57.1°C, 60 s 72°C, 240 s
eae-2 GATCGGCAACAGTTTCACCTG
ToxBF TGGCCTTGCGCTCTATAAGAACCT ToxB (823) This study 95°C, 60 s 60°C, 60 s 72°C, 240 s
ToxBR ACCACGCCGTGAGAATAATGTCCA
HlyA1F GGTGCAGCAGAAAAAGTTGTAG HlyA (1551) (13) 95°C, 60 s 55.5°C,60 s 72°C, 240 s
HlyA1R TCTCGCCTGATAGTGTTTGGTA
EspPF CGGCAGAGTATCATCAAGAGC EspP (397) This study 95°C, 60 s 55.5°C, 60 s 72°C, 240 s
EspPR CATTAAATGGAGTTATGCGTC
KatPF TTTAAAACGCTGGGATTTGC KatP (1174) This study 95°C,60 s 52.0°C, 60 s 72°C, 240 s
KatPR CTCCTGAGAGGCGTCAGTTC
MalBU GACCTCGGTTTAGTTCACAGA MalB promoter (414) This study 95°C, 60 s 55.8°C, 60 s 72°C, 240 s
MalBDn AGCGCGTAGGACTGAAACACCATA
ORF1F TTTTTCAAAGCAAATGATGTGG ORF 1
pOSAK1 (385) This study 95°C, 60 s 49.8°C, 60 s 72°C, 240 s
ORF1R GGCGTAGCTAGGTTGAAATTATG
ORF2F CAA CCTAGCTACGCCACCAT ORF 2
pOSAK1 (869) This study 95°C, 60 s 54.3°C, 60 s 72°C, 240 s
ORF2R CATCAGGCGGAAATACCACT
EAF1 CAGGGTAAAAGAAAGATGATAA Eaf (397) (14) 95°C, 60 s 49.8°C, 60 s 72°C, 240 s
EAF2 TATGGGGACCATGTATTATCA
BFP1 GATTGAATCTGCAATGGC Bfp (597) (15) 95°C, 60 s 51.6°C, 60 s 72°C, 240 s
BFP2 GGATTACTGTCCTCACATAT

*Ref., reference; ORF, open reading frame.

Main Article

TOP