Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 13, Number 9—September 2007

Dispatch

Anaplasma platys in Dogs, Chile

Katia Abarca*Comments to Author , Javier López†‡, Cecilia Perret*, Javier Guerrero†, Paula Godoy*, Ana Veloz*, Fernando Valiente-Echeverría*, Ursula León*, Constanza Gutjahr†, and Teresa Azócar*
Author affiliations: *Pontificia Universidad Católica de Chile, Santiago, Chile; †Faculty of Veterinary Medicine, Universidad Santo Tomás, Santiago, Chile; ‡Alcántara Veterinary Clinic, Santiago, Chile;

Main Article

Table 1

Ehrlichia/Anaplasma spp. PCR primers used in this study

Ehrlichia/Anaplasma spp. (primer type) Primer Primer sequence (5′→3′) Region Reference
Ehrlichia spp., 
A. phagocytophilum, 
E. canis, E. chaffeensis, 
E. ewingii, A. platys (outer) EHR-OUT1 CTGGCGGCAAGCCTAACACATGCCAACAT 16S rRNA (5)
EHR-OUT2 GCTCGTTGCGGGACTTAACCCAACATCTCACGAC 16S rRNA (5)
Ehrlichia spp. (inner) GE2F GTTAGTGGCATACGGGTGAAT 16S rRNA (5)
EHRL3-IP2 TCATCTAATAGCGATAAATC 16S rRNA (5)
A. phagocytophilum (inner) ge9f AACGGATTATTCTTTATAGCTTGCT 16S rRNA (6)
ge2 GGCAGTATTAAAAGCAGCTCCAGG 16S rRNA (6)
E. canis, E. chaffeensis, 
E. ewingii (inner) HE3-R CTTCTATAGGTACCGTCATTATCTTCCCTAT 16S rRNA (5)
E. canis (inner) E. canis CAATTATTTATAGCCTCTGGCTATAGGAA 16S rRNA (5)
E. chaffeensis (inner) E. chaffeensis CAATTGCTTATAACCTTTTGGTTATAAATA 16S rRNA (5)
E. ewingii (inner) E. ewingii CAATTCCTAAATAGTCTCTGACTATT 16S rRNA (5)
E. equi (inner) E. equi-3-IP2 GTCGAACGGATTATTCTTTATAGCTTG 16S rRNA (5)
E. platys (inner) EHRL3-IP2 TCATCTAATAGCGATAAATC 16S rRNA (5,7)
E. platys GATTTTTGTCGTAGCTTGCTA 16S rRNA (7)
E. platys (outer) EEgro1F GAGTTCGACGGTAAGAAGTTCA groESL (8)
EEgro2R CAGCGTCGTTCTTACTAGGAAC groESL (8)
A. platys (inner) SQ3F ATTAGCAAGCCTTATGGGTC groESL (9)
SQ5F TCAGTGTGTGAAGGAAGTTG groESL (9)
SQ4R CTTTAGGCTATCAAGAGATG groESL (9)
SQ6R TGCTTCCTATGTTCTTATCG groESL (9)

Main Article

TOP