Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 14, Number 3—March 2008


Genetic Variability of West Nile Virus in US Blood Donors, 2002–2005

Andriyan Grinev*, Sylvester Daniel*, Susan Stramer†, Susan Rossmann‡, Sally Caglioti§, and Maria Rios*Comments to Author 
Author affiliations: *Food and Drug Administration, Bethesda, Maryland, USA; †American Red Cross, Gaithersburg, Maryland, USA; ‡Gulf Coast Regional Blood Center, Houston, Texas, USA; §Blood System Laboratories, Tempe, Arizona, USA;

Main Article

Table 2

Primer sets used for PCR analyses of West Nile virus and sizes of overlapping amplicons*

Set/location Amplicon size, kb Name Sequence (5′ → 3′)
7/F4810–R5650 0.85 F4810 CGCCTGGACCCATACTGG
10/F6690–R7550 0.85 F6690 CCTCCTCATGCAGCGGAA
11/F7420–R8260 0.85 F7420 CCACACCCATCATGCAGAA
13/F8920–R9810 0.9 F8920 CAGCTTTGGGTGCCATGTT
15/F10550–R11029 0.5 F10550 TGAGTAGACGGTGCTGCCTG

*Internal sequencing primers were also used and their sequences are available upon request.

Main Article