Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 14, Number 3—March 2008

Research

Chikungunya Fever in Travelers Returning to Europe from the Indian Ocean Region, 2006

Marcus Panning*1, Klaus Grywna*, Marjan Van Esbroeck†, Petra Emmerich*, and Christian Drosten*1Comments to Author 
Author affiliations: *Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany; †Prince Leopold Institute of Tropical Medicine, Antwerp, Belgium;

Main Article

Table 2

Real-time reverse transcription–PCR (RT-PCR) assay results for chikungunya virus (CHIKV)

Oligonucleotide name Purpose* Sequence and label, 5′ →3′ Position (GenBank accession no.)
ChikSI Forward primer, general CHIKV assay TGATCCCGACTCAACCATCCT 241-261 (AF369024)
ChikSII Forward primer, adapted assay for Indian Ocean strain CCGACTCAACCATCCTGGAT 246-265 (DQ443544)
ChikAsI Reverse primer, general CHIKV assay GGCAAACGCAGTGGTACTTCCT 323-302 (AF369024)
ChikAsII Reverse primer, adapted assay for Indian Ocean strain GGCAGACGCAGTGGTACTTCCT 323-302 (DQ443544)
ChikP Detection probe, CHIKV FAM-TCCGACATCATCCTCCTTGCTGGC-BHQ1 300-277 (AF369024)
ICP Detection probe, internal control DYXL-ATCGTTCGTTGAGCGATTAGCAG-BHQ2 Not applicable

*All oligonucleotides were used in the following assay: 25-µL reaction volume, 3 µL of RNA extract (Viral RNA Mini Kit, QIAGEN, Hilden, Germany), QIAGEN OneStep RT-PCR Kit, 600 nmol/L each primer, 200 nmol/L each probe. Cycling at 50°C for 30 min, 95°C for 15 min, 45 cycles each at 95°C for 15 s and 58°C for 30 s, LightCycler (Roche, Mannheim, Germany).

Main Article

1Current affiliation: University of Bonn Medical Centre, Bonn, Germany.

TOP