Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 14, Number 3—March 2008

Research

Discovering and Differentiating New and Emerging Clonal Populations of Chlamydia trachomatis with a Novel Shotgun Cell Culture Harvest Assay

Naraporn Somboonna*†, Sally Mead*, Jessica Liu†, and Deborah Dean*†‡Comments to Author 
Author affiliations: *Children’s Hospital Oakland Research Institute, Oakland, California, USA; †University of California, Berkeley, California, USA; ‡University of California School of Medicine, San Francisco, California, USA;

Main Article

Table 2

PCR and sequencing primers used for determining strain types of clonal isolates from reference strains and clinical samples

Primer Sequence (5′ → 3′) Location Ref
CTompA-F GTCCCGCCAGAAAAAGATAG –60 to –41 This study
CTompA-seqF ATAGCGAGCACAAAGAGAGC –44 to –25 This study
VB3 CATCGTAGTCAATAGAGGCAT 817 to 797 (22)
MVF3 TGTAAAACGACGGCCAGTGCCCGTGCAGCTTT 561 to 611 (22)
CTompA-B ACGGATAGTGTTATTAACAAAGAT 1261 to 1225 This study
CTompA-seqB GTAAAACGACGGCCAGT 562 to 596 This study
C16SrRNA-F CAGTCGAGAATCTTTCGCAAT 359 to 380 This study
C16SrRNA-seqF AAGGCTCTAGGGTTGTAAAGCACTTT 419 to 444 This study
C16SrRNA-B TACTGGCCATTGTAGCACGTGTGT 1230 to 1253 This study
Plasmid-PF5 AGACTTGGTCATAATGGACTT 1022 to 1002 This study
Plasmid-seqPF5 AGACTTGGTCATAATGGACTT 1022 to 1002 This study
Plasmid-PB5 TTGTCTCGGATTTTAAAAAATGT 588 to 566 This study
FCabortus GGTATGTTTAGGCATCTAAAA 172 to 192 This study
RCabortus2 GGCCATTGTAGCACGTGTGTA 1248 to 1228 This study

Main Article

TOP