Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 14, Number 8—August 2008

Research

Genetic and Serologic Properties of Zika Virus Associated with an Epidemic, Yap State, Micronesia, 2007

Robert S. Lanciotti*Comments to Author , Olga L. Kosoy*, Janeen J. Laven*, Jason O. Velez*, Amy J. Lambert*, Alison J. Johnson*, Stephanie M. Stanfield*, and Mark R. Duffy*
Author affiliations: *Centers for Disease Control and Prevention, Fort Collins, Colorado, USA;

Main Article

Table 3

Description and performance characteristics of Zika virus real-time RT-PCR primer/probe sets*

PrimerGenome position†Sequence (5′ → 3′)Sensitivity, no. copiesSpecificity‡
ZIKV 835835–857TTGGTCATGATACTGCTGATTGC
ZIKV 911c911–890CCTTCCACAAAGTCCCTATTGC100ZIKV
ZIKV 860-FAM860–886CGGCATACAGCATCAGGTGCATAGGAG
ZIKV 10861086–1102CCGCTGCCCAACACAAG
ZIKV 1162c1162–1139CCACTAACGTTCTTTTGCAGACAT25ZIKV
ZIKV 1107-FAM1107–1137AGCCTACCTTGACAAGCAGTCAGACACTCAA

*RT-PCR, reverse transcription–PCR; ZIKV, Zika virus.
†Based on ZIKV MR 766 GenBank accession no. AY632535.
‡ZIKV specificity indicates a positive result with ZIKV only and no reactivity with dengue virus-1 (DENV-1), DENV-2, DENV-3, DENV-4, West Nile virus, St. Louis encephalitis virus, yellow fever virus, Powassan virus, Semliki Forest virus, o’nyong-nyong virus, chikungunya virus, and Spondweni virus.

Main Article

TOP