Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 14, Number 8—August 2008

Dispatch

Genotyping Rickettsia prowazekii Isolates

Yong Zhu*, Aaron Medina-Sanchez*, Donald Bouyer*, David H. Walker*, and Li Zhao*Comments to Author 
Author affiliations: *University of Texas Medical Branch, Galveston, Texas, USA;

Main Article

Table 1

Primers for 6 loci of Rickettsia prowazekii genomic DNA sequences

Target sequence Sequences of forward primer/reverse primer (5′ → 3′) PCR product size, bp Reference
rp028 TTGATATAGGTTGCGGAGTCGGTGTTA/TCATTGATGGCTTGTAGTTTTTCTGCT 682 (9)
rp181 ATTATGCAAATAATGCAG/GCATCGGATAAGTTAGTTCA 390 This study
rp195 TTTATTGGGGATTTACCTTT/CAAGTGTTAGATAGCTTGCT 384 This study
rp272/rp273 TCTTGCGATACAGTAAGCAC/TATTCGCTCCTTACCAGTTA 612 This study
rp308/rp309 TTAACAGAAGTAATAATAATTG/AGCAATAGAATTTGATAAGCA 369 This study
rp691/rp692 AGAAATTTGTATTGCATTTTTATG/GCTCTAGAAGCTATTGCTGA 447 This study

Main Article

TOP