Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 15, Number 1—January 2009

Dispatch

Clonal Multidrug-Resistant Corynebacterium striatum Strains, Italy

Floriana Campanile, Edoardo Carretto, Daniela Barbarini, Annalisa Grigis, Marco Falcone, Antonio Goglio, Mario Venditti, and Stefania StefaniComments to Author 
Author affiliations: University of Catania, Catania, Italy (F. Campanile, S. Stefani); Policlinico “San Matteo,” Pavia, Italy (E. Carretto, D. Barbarini); Ospedali Riuniti, Bergamo, Italy (A. Grigis, A. Goglio); University Roma La Sapienza, Rome, Italy (M. Falcone, M. Venditti)

Main Article

Table 1

Primer conditions, PCR products, and related sequences confirmed by BLAST analysis of 36 strains of multidrug-resistant Corynebacterium striatum, Italy, 2005–2007*

Primer Related resistance Sequence (5′ → 3′) Temperature, °C Size, bp BLAST from–to, bp
ermX up
ermX down Erythromycin and
clindamycin AACCATGATTGTGTTTCTGAACG
ACCAGGAAGCGGTGCCCT 57 566 2,285–2,850
tetA up
tetB down Tetracycline, oxytetracycline,
and oxacillin TTAGCGTTCGGCGACCTGG
AACTGGGTGCCTTCAGGGTC 58 1,829 5,496–7,324
cmxB up
cmxA down Cloramphenicol (2 identical subunits) AGTCGGTATGGTCGTCGGC
GCTCCGATATTCAATGCTGCG 57 879 16,031–16,909
36,078–36,956
aphA1 up
aphA1 down Aminoglycoside GGCAAGATCCTGGTATCGGTCT
AGACTAAACTGGCTGACGGCAT 57 480 41,859–42,338
repB up
repB down Replicase CGATCTGGAATTTGTCTGCCGT
CTGGTTGATAGACCCCGTGT 57 875 32,523–33,397

*BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) analysis of each gene with pTP10 sequence (GenBank accession no. AF024666) showed nucleotide identities >99%.

Main Article

TOP