Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 15, Number 1—January 2009

Dispatch

Rickettsia helvetica in Dermacentor reticulatus Ticks

Marinko DobecComments to Author , Dragutin Golubic, Volga Punda-Polic, Franz KaeppeliComments to Author , and Martin Sievers
Author affiliations: Medizinische Laboratorien Dr F. Kaeppeli, Zurich, Switzerland (M. Dobec, F. Kaeppeli); University of Split School of Medicine, Split, Croatia (M. Dobec, V. Punda-Polic); County Hospital, Cakovec, Croatia (D. Golubic); Split University Hospital, Split (V. Punda-Polic); Zurich University of Applied Sciences, Waedenswil, Switzerland (M. Sievers)

Main Article

Table 1

Primers and probes designed for real-time PCR*

Species Primers and probe Sequence (5′ → 3′)
Rickettsia helvetica ompB_forward GATTTCGACGGTAAAATTACC
ompB_reverse GCTACCGATATTACCTACAG

ompB_probe†
ACTCTACTGCTACAAGTATGGTTGCTACAG
R. slovaca ompA_forward GTGATAATGTTGGCAATAATAATTGG
ompA_reverse CTCTCGTTATAATCGAACCAAC

ompA_probe†
CAGCAGGAGTACCATTAGCTACCCCTCC
Dermacentor spp. ITS_forward GTGCGTCCGTCGACTCGTTTTGA
ITS_reverse ACGGCGGACTACGACGGAATGC

*Amplified products: 162 bp (R. helvetica); 228 bp (R. slovaca); 646 bp (D. reticulatus); standard curve: slope; Y-intercept and correlation coefficient:
–3.634, 40.129, 0.9937 (R. helvetica); –0.23, 42.82, 0.9942 (R. slovaca); ITS, internal transcribed spacer.
†The TaqMan probes were labeled with the fluorescent dyes FAM at the 5' end and TAMRA as quencher at the 3' end.

Main Article

TOP