Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 15, Number 2—February 2009

Dispatch

Enteroviruses in Patients with Acute Encephalitis, Uttar Pradesh, India

Gajanan N. Sapkal, Vijay P. Bondre, Pradip V. Fulmali, Pooja Patil, Vipul Dadhania, Vijay M. Ayachit, Daya Gangale, K.P. Kushwaha, A.K. Rathi, Shobha D. Chitambar, Akhilesh Chandra Mishra, Milind M. GoreComments to Author , and Gopalkrishna
Author affiliations: National Institute of Virology, Pune, India (G.N. Sapkal, V.P. Bondre, P.V. Fulmali, P. Patil, V. Gopalkrishna, V. Dadhania, V.M. Ayachit, D. Gangale, S.D. Chitambar, A.C. Mishra, M.M. Gore); Baba Raghav Das Medical College, Gorakhpur, India (K.P Kushwaha, A.K. Rathi)

Main Article

Table 1

Primers used for PCR and sequencing for enterovirus isolates from encephalitis patients, Uttar Pradesh, India, 2006*

Serial no. Region Location Primer sequence (5′ → 3′) Product size, bp
1 5’ NCR 64–84 CGGTACCTTTGTACGCCTGT 537
2 5’ NCR 601–582 ATTGTCACCATAAGCAGCCA 537
3 5’ NCR 166–186 CAAGCACTTCTGTTTCCCCGG 400
4 5’ NCR 566–546 GAAACACGGACACCCAAAGTA 400
5 VP1/2A EV-012 (2917–2936) ATGTAYGTICCICCIGGIGG 457
6 VP1/2A EV-040 (2917–2936) ATGTAYRTICCIMCIGGIGC 457
7 VP1/2A EV-011 (3374–3355) GCICCIGAYTGITGICCRAA 457
8 VP1 cDNA AN32 (3009–3002) GTYTGCCA NA
9 VP1 cDNA AN33 (3009–3002) GAYTGCCA NA
10 VP1 cDNA AN34 (3111–3104) CCRTCRTA NA
11 VP1 cDNA AN35 (3009–3002) RCTYTGCCA NA
12 VP3 224(1977–1996) GCIATGYTIGGIACICAYRT 762
13 VP1 222 (2969–2951) CICCIGGIGGIAYRWACAT 762
14 VP1 AN89 (2602–2627) CCAGCACTGACAGCAGYNGARAYNGG 348–393
15 VP1 AN88 (2977–2951) TACTGGACCACCTGGNGGNAYRWACAT 348–393

*NCR, noncoding region of viral genome; VP, virion protein; NA, not applicable.

Main Article

TOP