Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 15, Number 2—February 2009

Dispatch

Isolation of Kyasanur Forest Disease Virus from Febrile Patient, Yunnan, China

Jinglin Wang, Hailin Zhang, Shihong Fu, Huanyu Wang, Daxin Ni, Roger Nasci, Qing Tang, and Guo-Dong LiangComments to Author 
Author affiliations: State Key Laboratory for Infectious Disease Prevention and Control, Beijing, China (J. Wang, S. Fu, H. Wang, D. Ni, Q. Tang, G. Liang); Yunnan Institute of Endemic Disease Control and Prevention, Dali, China (J. Wang, H. Zhang); Centers for Disease Control and Prevention, Fort Collins, Colorado, USA (R. Nasci)

Main Article

Table

Primers used to sequence the PrM-E and NS5 genes of Nanjianyin virus*

Primers Primers sequence (5′ → 3′)
PrM-E gene primers
KFD1F(105-124) CGGACTGGTATTGATGCG
KFD1R(1357-1340) TCTTCTCGGACTGCGTTG
KFD2F(1100-1117) ACCAGGCGAGCACAGTCT
KFD2R(1952-1935) CCTCCTCCAGTTGTTTCCA
KFD3F(1652-1673) GAGTGCCCGTGGCTAACATAGA
KFD3R(2832-2812) CTTGGTCCTCATTCCCATCCC
NS5 gene primers
FU1PM (8908-8933) TACAACATGATGGGVAARAGWGARAA
cFD3 (9961-9983) AGCATGTCTTCCGTGGTCATCCA

*NS, nonstructural protein.

Main Article

TOP