Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 15, Number 3—March 2009

Dispatch

Rickettsia spp. in Ticks, Poland

Tomasz ChmielewskiComments to Author , Edyta Podsiadly, Grzegorz Karbowiak, and Stanislawa Tylewska-Wierzbanowska
Author affiliations: National Institute of Public Health, Warsaw, Poland (T. Chmielewski, E. Podsiadly, S. Tylewska-Wierzbanowska); W. Stefanski Institute of Parasitology of the Polish Academy of Sciences, Warsaw (G. Karbowiak)

Main Article

Table 1

Oligonucleotide primers used for PCR amplification and sequencing of rickettsial species in ticks, Poland, 2005–2007

No. Primers Fragment gene (size, bp) Nucleotide sequences (5′ → 3′) Reference
1 RpCS.409d Citrate synthase
(850)
CCTATGGCTATTATGCTTGC (5)

RpCS.1258n
ATTGCAAAAAGTACAGTGAACA

2 Rr190-70 Outer membrane protein A
(632)
ATGGCGAATATTTCTCCAAAA (3)

Rr190-701
GTTCCGTTAATGGCAGCATCT

3 Rr17.61p 17-kDa genus-common antigen
(434) GCTCTTGCA ACT TCT ATG TT (7)
Rr17.492n CATTGTTCGTCAGGTTGGCG

Main Article

TOP