Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 15, Number 4—April 2009
THEME ISSUE
The Amazon Region

Research

Human Febrile Illness Caused by Encephalomyocarditis Virus Infection, Peru

M. Steven Oberste, Eduardo Gotuzzo, Patrick Blair, W. Allan Nix, Thomas G. Ksiazek, James A. Comer, Pierre E. Rollin, Cynthia S. Goldsmith, James Olson, and Tadeusz J. Kochel
Author affiliations: Centers for Disease Control and Prevention, Atlanta, Georgia, USA (M.S. Oberste, W.A. Nix, T.G. Ksiazek, J.A. Comer, P. Rollin, C.S. Goldsmith); Universidad Peruana Cayetano Heredia, Lima, Peru (E. Gotuzzo); Naval Medical Research Center Detachment, Lima (P. Blair, J. Olson, T.J. Kochel)

Main Article

Table

Oligonucleotide primers used for cardiovirus PCR amplification and sequencing*

Primer Sequence (5′ → 3′) Region Coordinates Reference
AN312 GARTVWCGYRAAGRAAGCAGT 5′-NTR 455–475 This study
AN315 GGYRCTGGGGTTGYRCCGC 5′-NTR 618–600 This study
AN283 GCAGACGGWTGGGTNACNGTNTGG VP3 2559–2582 This study
AN285 AGAGTAACCTCTACRTCRCAYTTRTA VP1 3097–3072 This study
AN393 TTTCCACTCAAGTCTAARCARGAYT VP1 3015–3049 This study
AN286 AAGAAGACAGTCGGACGNGGRCARAANAC VP1 3472–3444 This study
P1 CCCTACCTCACGGAATGGGGCAAAG 3D 7655–7631 (24)
P2 GGTGAGAGCAAGCCTCGCAAAGACAG 3D 7370–7395 (24)

*NTR, nontranslated region; VP1, viral protein 1.

Main Article

TOP