Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 15, Number 5—May 2009

Research

CTX-M β-Lactamases in Escherichia coli from Community-acquired Urinary Tract Infections, Cambodia

Etienne RuppéComments to Author , Sopheak Hem, Sovannarith Lath, Valérie Gautier, Frédéric Ariey, Jean-Louis Sarthou, Didier Monchy, and Guillaume Arlet
Author affiliations: Institut Pasteur du Cambodge, Phnom Penh, Cambodia (E. Ruppé, S. Hem, S. Lath, F. Ariey, J.-L. Sarthou, D. Monchy); Université Pierre et Marie Curie-Paris Faculté de Médecine, Paris, France (V. Gautier, G. Arlet); Assistance Publique-Hôpitaux de Paris–Hôpital Tenon, Paris (V. Gautier, G. Arlet)

Main Article

Table 1

Primers used to study CTX-M β-lactamases in Escherichia coli, Cambodia, 2004–2005

Gene detected Primer name Primer sequence (5′ → 3′) Reference
blaTEM C TCG GGG AAA TGT GCG CG (23)

D
TGC TTA ATC AGT GAG GCA CC
blaSHV OS-5 TTA TCT CCC TGT TAG CCA CC (24)

OS-6
GAT TTG CTG ATT TCG CTC GG
blaCTX-M MA-1 SCS ATG TGC AGY ACC AGT AA (23)

MA-2
CCG CRA TAT GRT TGG TGG TG
blaCTX-M group 9 M9U ATG GTG ACA AAG AGA GTG CA (23)

M9L
CCC TTC GGC GAT GAT TCT C
blaCTX-M group 1 M13U GGT TAA AAA ATC ACT GCG TC (23)

M13L
TTG GTG ACG ATT TTA GCC GC
blaampC AmpC1 AAT GGG TTT TCT ACG GTC TG (25)

AmpC2
GGG CAG CAA ATG TGG AGC AA
blaVEB casF CGA CTT CCA TTT CCC GAT GC (26)

casB
GGA CTC TGC AAC AAA TAC GC
blaOXA-1 OXA-1up TAT CAA CTT CGC TAT TTT TTT A (27)

OXA-1low
TTT AGT GTG TTT AGA ATG GTG A
blaCMY CF1 ATGATGAAAAAATCGTTATGC (28)

CF2
TTGTAGCTTTTCAAGAATGCGC
chuA ChuA.1 GAC GAA CCA ACG GTC AGG AT (29)

ChuA.2
TGC CGC CAG TAC CAA AGA CA
ygaA YgaA.1 TGA AGT GTC AGG AGA CGC TG (29)

YgaA.2
ATG GAG AAT GGG TTC CTC AAC
TspE4C2 TspE4C2.1 GAG TAA TGT CGG GGC ATT CA (29)
TspE4C2.2 CGC GCC AAC AAA GTA TTA GC

Main Article

TOP