Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 15, Number 5—May 2009

Research

Chloroquine-Resistant Haplotype Plasmodium falciparum Parasites, Haiti

Berlin L. Londono, Thomas P. Eisele, Joseph Keating, Adam Bennett, Chandon Chattopadhyay, Gaetan Heyliger, Brian Mack, Ian Rawson, Jean-Francois Vely, Olbeg Désinor, and Donald J. KrogstadComments to Author 
Author affiliations: Tulane University, New Orleans, Louisiana, USA (B.L. Londono, T.P. Eisele, J. Keating, A. Bennett, B. Mack, D.J. Krogstad); University of Pamplona, Pamplona, Colombia (B.L. Londono); Hôpital Albert Schweitzer, Deschapelles, Haiti (C. Chattopadhyay, G. Heyliger, I. Rawson); Swiss Tropical Institute, Basel, Switzerland (C. Chattopadhyay); Ministry of Health, Port-au-Prince, Haiti (J.-F. Vely); US Agency for International Development, Port-au-Prince (O. Désinor)

Main Article

Table 1

Primers used to amplify Plasmodium falciparum DNA during study in Haiti*

Primers (5′ → 3′) Amplicon, bp Tm, °C Reference
Primers for P. falciparum species-specific SSU rRNA gene 276 (22)
Forward: AACAGACGGGTAGTCATGATTGAG 56.5
Reverse: GTATCTGATCGTCTTCACTCCC 54.5
Primers for single-step pfcrt gene PCR 170 (23)
Forward: TgTgCTCATgTGTTTAAACTT 50.6
Reverse: AATAAAgTTgTgAgTTTCggA 49.8
Primers for nested (2-step) pfcrt gene 573 (24,25)
First round of amplification
Forward (CRTP1): CCGTTAATAATAAATACACGCAG 49.9
Reverse (CRTP2): CGGATGTTACAAAACTATAGTTACC 51.5
Second round of amplification
Forward (CRTD1): TGTGCTCATGTGTTTAAACTT 134 50.6
Reverse (CRTD2): CAAAACTATAGTTACCAATTTTG 46.1

*Nucleotides in upper case letters were conserved in 100% of sequences at those positions, and nucleotides in lower case letters were conserved in most (e.g., >50%) sequences at those positions. Tm, melting (annealing) temperature; SSU, small subunit; pfcrt, P. falciparum chloroquine resistance transporter.

Main Article

TOP