Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 15, Number 9—September 2009

Research

Recent Ancestry of Kyasanur Forest Disease Virus

Rajeev Mehla, Sandeep R.P. Kumar, Pragya Yadav, Pradip V. Barde, Prasanna N. Yergolkar, Bobbie R. Erickson, Serena A. Carroll, Akhilesh C. Mishra, Stuart T. Nichol, and Devendra T. MouryaComments to Author 
Author affiliations: National Institute of Virology, Pune, India (R. Mehla, S.R.P. Kumar, P. Yadav, P.V. Barde, P.N. Yergolkar, A.C. Mishra, D.T. Mourya); Centers for Disease Control and Prevention, Atlanta, Georgia, USA (B.R. Erickson, S.A. Carroll, S.T. Nichol)

Main Article

Table 2

Primers used for diagnostic nested reverse transcription–PCR and genotyping of KFD virus, India*

Gene Primer Genome location Primer sequence (5′ → 3′) Product, bp Type
preM–env
KFD-EF2 459–478 TGGTGTTCTCTGCGACAGTT 780 Genotyping
KFD-ER2 1258–1238 TCTGTCACTCTGGTCTCGCTT
KFD-EF3† 606–628 TCATTCGAGTGTGTGTCACCATT
KFD-ER1†
701–678
TTCCGTATTCCAGTGACACTCGCT


NS5 KFD-F3 9422–9441 GGCTGAGTCATGGACATCAT 642
KFD-R4 11046–11063 TCCACTCGTGTGGATGCT
KFD-F4† 9660–9680 TGAGACCTTCTGACGACCGCT
KFD-R3† 9801–9819 TCCTTCATCGTCAACTCAT

*preM, premembrane; env, envelope; KFD, Kyasanur Forest disease; NS5, nonstructural protein 5.
†Internal primers for sequencing some isolates.

Main Article

TOP