Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 15, Number 9—September 2009

Research

Predicting Phenotype and Emerging Strains among Chlamydia trachomatis Infections

Deborah DeanComments to Author , William J. Bruno, Raymond Wan, João P. Gomes, Stéphanie Devignot, Tigist Mehari, Henry J.C. de Vries, Servaas A. Morré, Garry Myers, Timothy D. Read, and Brian G. Spratt
Author affiliations: Children’s Hospital Oakland Research Institute, Oakland, California, USA (D. Dean, R. Wan, T. Mehari); University of California, San Francisco, California, USA (D. Dean); University of California, Berkeley, California, USA (D. Dean); Los Alamos National Laboratories, Los Alamos, New Mexico, USA (W.J. Bruno); National Institute of Health, Lisbon, Portugal (J.P. Gomes); Institut de Médecine Tropicale du Service de Santé des Armées, Marseille, France (S. Devignot); University of Amsterdam, the Netherlands (H.J.C. de Vries); Vrije Universiteit Medical Center, Amsterdam (S.A. Morré); University of Maryland School of Medicine, Baltimore, Maryland, USA (G. Myers); Emory University, Atlanta, Georgia, USA (T.D. Read); Imperial College, London, UK (B.G. Spratt)

Main Article

Table 1

Primer pairs used for PCR of chlamydiaceae species and strains

Locus Region Primer name Sequence (5′ → 3′) Length of sequence, bp
glyA CT432 FglyA GAAGACTGTGGCGCTGTTTTATGG 522


RglyA
CTTCCTGAGCGATCCCTTCTGAC

mdhC CT376 FmdhC GGAGATGTTTTTGGCCTTGATTGT 519


RmdhC
CGATTACTGCACTACCACGACTCT

pdhA CT245 FpdhA CTACAGAAGCCCGAGTTTTT 549


RpdhA
CTGTTTGTTGCATGTGGTGATAAG

yhbG CT653 FyhbG TCAAGTCAATGCAGGAGAAAT 504


RyhbG
GATAGTGTTGACGTACCATAGGAT

pykF CT332 FpykF ATCTTATCGCTGCTTCGTT 525


RpykF
cagcaataatagggagata

lysS CT781 FlysS GAAGGAATCGATAGAACGCATAAT 576


RlysS
ATACGCCGCATAACAGGGAAAAAC

leuS CT209 FleuS TCCCTTGGTCGATCTCCTCAC 519
RleuS GGGCATCGCAAAAACGTAAATAGT

Main Article

TOP