Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 16, Number 1—January 2010

Research

Actinobaculum schaalii, a Common Uropathogen in Elderly Patients, Denmark

Steffen BankComments to Author , Anders Jensen, Thomas M. Hansen, Karen M. Søby, and Jørgen Prag
Author affiliations: Viborg Hospital, Viborg, Denmark (S. Bank, T.M. Hansen, K.M. Søby, J. Prag); Aarhus University, Aarhus, Denmark (A. Jensen)

Main Article

Table 1

Sequences of primers and probe used for identification of Actinobaculum schaalii, Denmark, 2008–2009

Primer or probe Sequence (5′ → 3′)
UP-1 GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYGA
UP-2r AGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRTCNGTCAT
UP-1S GAAGTCATCATGACCGTTCTGCA
UP-2Sr AGCAGGGTACGGATGTGCGAGCC
A.s-forward GGCCATGCAGTGGACCTC
A.s-reverse GCACATCATCACCGGAAAGA
A.s-probe TCCGAATCGGTCAATACCTTCGC

Main Article

TOP