Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 16, Number 10—October 2010

Dispatch

Klassevirus Infection in Children, South Korea

Tae-Hee Han, Cheol-Hwan Kim, Ju-Young ChungComments to Author , Sang-Hun Park, and Eung-Soo Hwang
Author affiliations: Author affiliations: Inje University College of Medicine, Seoul, South Korea (T.-H. Han, J.-Y. Chung); Sungkyunkwan University, Seoul (C.-H. Kim); Seoul Metropolitan Government Research Institute of Public Health and Environment, Seoul (S.-H. Park); Seoul National University College of Medicine, Seoul (E.-S. Hwang)

Main Article

Table

Primers used in PCR for Aichi virus and klassevirus*

Virus/primer Sequence (5′ → 3′) Gene Reference
Aichi virus
6261 ACA CTCCCACCTCCCGCCAGTA (1st) 3CD (12)
6779 GGAAGAGCTGGGTGTCAAGA
C94b GACTTCCCCGGAGTCGTCGTCT (2nd) 3CD (13)
246k
GACATCCGGTTGACGTTGAC


Klassevirus
LG0118 ATGGCAACCCTGTCCCTG AG (1st) 3D (4)
LG0117 GAAACCCAACCACGCTGTA (4)
KL3DF GTCTGGTCTATYGAYTACTCTTGCTTT (2nd) 3D This study
KL3DR AGGACGGAGTAGGGRGTRAA This study
LG0119 GCTAACTCTAATGCTGCCACC (1st) VP0/VP1 (4)
LG0136 GCTAGGTCAGTGGAAGGATCA (4)
KLVPF GTCACYCCMAACACCTCCACTGAAG (2nd) VP0/VP1 This study
KLVPR TTCTGCRCCATCRGCTCCCGA This study
KL2C-F1 CTCGCYGAGGACATCACGGA (1st) 2C This study
KL2C-R1 GTACAGGTACACRACCAGTGGCT This study
KL2C-F2 AATCTGCTGCCCAGGCCGC (2nd) 2C This study
KL2CR2 AGGGAGATGGCRGAGAGAGCTGT This study

*VP, viral protein.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO