Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 16, Number 11—November 2010

Research

Effect of Vaccination on Bordetella pertussis Strains, China

Liu Zhang1, Yinghua Xu1, Jianhong Zhao, Teemu Kallonen, Shenghui Cui, Yunqiang Xu, Qiming Hou, Fengxiang Li, Junzhi Wang, Qiushui He, and Shumin ZhangComments to Author 
Author affiliations: National Institute for the Control of Pharmaceutical and Biological Products, Beijing, People’s Republic of China (L. Zhang, Y. Xu, S. Cui, Q. Hou, F. Li, J. Wang, S. Zhang); Hebei Medical University, Shijiazhuang, PRC (J. Zhao); The Second Hospital of Shijiazhuang City, Shijiazhuang (Y. Xu); National Institute for Health and Welfare, Turku, Finland (T. Kallonen, Q. He); University of Turku, Turku (T. Kallonen)

Main Article

Table

Oligonucleotide primers designed and used for PCR amplification and sequencing of Bordetella pertussis, China*

Primer Sequence, 5′ → 3′ Gene Position
prn-1F ATGTCTCTGTCACGCATTGTCA prn 151–172
prn-1R GTCCTGCATGACGACCAGCTTG prn 1653–1632
prn-2F CTCGAACGTCGGTGCGCTAC prn 1479–1498
prn-2R TCGCGTCCAGGTAGAAACCG prn 2347–2328
ptxA-F GGCACCATCAAAACGCAGAGGGG ptxA 476–498
ptxA-R ATTACCGGAGTTGGGCGGGGCTG ptxA 1347–1325
fim2-F ACCCATGCAAATCCCTTTCCAACGC fim2 177–201
fim2-R GGGGGTTGGCGATTTCCAGTTTCTC fim2 877–853
fim3-F ATGTCCAAGTTTTCATACCCTGCCT fim3 336–360
fim3-R TTCGTCTCCTGACGCCGCGTAGCGG fim3 1033–1009
tcfA-1F CCACATTGATTCAGGCCGCT tcfA 251–270
tcfA-1R CGTCCGCAGGAGACTTGGAA tcfA 1096–1077
tcfA-2F GACTCCGGTATGTCCGATTC tcfA 976–995
tcfA-2R CTACCAGGCGTAGCGATAGC tcfA 2346–2327

*Primer positions are listed according to the numbering of the sequences of the following GenBank accession nos.: ptxA, M13223; prn, J04560; fim2, Y00527; fim3, X51543; and tcfA, U16754. prn, pertactin; ptx, pertussis toxin; fim, fimbriae; tcf, tracheal colonization factor.

Main Article

1These authors contributed equally to this article.

TOP