Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 16, Number 12—December 2010

Letter

Molecular Detection of Bartonella alsatica in Rabbit Fleas, France

Tahar Kernif, Philippe Parola, Jean-Claude Ricci, Didier Raoult, and Jean-Marc RolainComments to Author 
Author affiliations: Author affiliations: Université de la Méditerranée, Marseille, France (T. Kernif, P. Parola, D. Raoult, J.-M. Rolain); Institut Méditerranéen du Patrimoine Cynégétique et Faunistique, Vergèze, France (J.-C. Ricci)

Main Article

Table

Oligonucleotide primers and TaqMan* fluorescent probe sequences of hsp60 and gyrB genes used for reverse transcription PCRs of Bartonella alsatica

Gene
Oligonucleotide
Sequence (5′ → 3′)
Length, bp
Amplicon size, bp
hsp60 B_alsa_hsp60_F TGCTAACGCTATGGAAAAAGTTG 23 108
B_alsa_hsp60_R CCACGATCAAACTGCATTCC 20

B_alsa_hsp60_P
6FAM-TGTCGAAGAAGCAAAAACGGCTGAAACC-TAMRA
28

gyrB B_alsa_gyrB_F CGAAGCAAAACTTCTTATTAGTAAGGT 27 126
B_alsa_gyrB_R GCAAGCTTTCCTGGCAGAG 19
B_alsa_gyrB_P 6FAM-ATAGAGGCTGCTGCGGCGCG-TAMRA 20

*Applied Biosystems, Courtaboeuf, France.
hsp60, heat shock protein 60; gyrB, DNA gyrase subunit B.

Main Article

TOP