Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 16, Number 2—February 2010

Dispatch

White-Nose Syndrome Fungus (Geomyces destructans) in Bat, France

Sébastien J. Puechmaille, Pascal Verdeyroux, Hubert Fuller, Meriadeg Ar Gouilh, Michaël Bekaert, and Emma C. TeelingComments to Author 
Author affiliations: University College Dublin, Dublin, Ireland (S.J. Puechmaille, H. Fuller, M. Bekaert, E.C. Teeling); Groupe Chiroptères Aquitaine, Erdoia, France (P. Verdeyroux); Institut Pasteur, Paris, France (M. Ar Gouilh)

Main Article

Table

Primers used for PCR amplification and sequencing of fungus in bats, France*

Gene Primer sequence (5′ → 3′) PCR
ITS
TCCTCCGCTTATTGATATGC Forward
GGAAGTAAAAGTCGTAACAAGG
Reverse
SSU rRNA CTGGTTGATTCTGCCAGT Forward
AAACCTTGTTACGACTTTTA Reverse
CCGGAGAAGGAGCCTGAGAAAC
AACTTAAAGGAATTGACGGAAG
CTCATTCCAATTACAAGACC
GAGTTTCCCCGTGTTGAGTC

*ITS, internal transcribed spacer; SSU, small subunit.
†Used for sequencing only.

Main Article

TOP