Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 16, Number 3—March 2010


Borrelia, Ehrlichia, and Rickettsia spp. in Ticks Removed from Persons, Texas, USA

Phillip C. WilliamsonComments to Author , Peggy M. Billingsley, Glenna J. Teltow, Janel P. Seals, Meredith A. Turnbough, and Samuel F. Atkinson
Author affiliations: University of North Texas Health Science Center, Fort Worth, Texas, USA (P.C. Williamson, P.M. Billingsley, J.P. Seals); Texas Department of State Health Services, Temple, Texas, USA (G.J. Teltow); University of North Texas, Denton, Texas, USA (M.A. Turnbough, S.F. Atkinson)

Main Article

Table 1

Nucleotide sequence of primers used for PCR screening of tick specimens removed from humans, Texas, October 1, 2004, to September 30, 2008*

Primer name
Primer sequence (5′ → 3′)
Tick DNA
85F 12S TTAAGCTTTTCAGAGGAATTTGCTC Unknown Primary 54.0 This study
225R 12S TTTWWGCTGCACCTTGACTTAA Unknown Primary 52.7 This study
Borrelia spp.
FlaLS flaB AACAGCTGAAGAGCTTGGAATG Genus Primary 57.5 (4)
BL-Fla 522F flaB GGTACATATTCAGATGCAGACAGAGGG B. lonestari Primary 61.3 This study
BL-Fla 1182R flaB GCACTTGATTTGCTTGTGCAATCATAGCC B. lonestari Primary 64.0 This study
BL-Fla 662F flaB CTGAAGAGCTTGGAATGCAACCTGC B. lonestari Primary 62.8 This study
BL-Fla 860R flaB GAGCTAATCCCACCTTGAGCTGG B. lonestari Primary 61.2 This study
BL-Fla 341F flaB AGCTGATGATGCTGCTGGTATGGG Genus Alternate 63.2 This study
BL-Fla 730R flaB GCTTGTGCTCCAGTTAGTGATGCTGG Genus Alternate 64.1 This study
BL-16S 227F 16S TCACACTGGAACTGAGATACGGTCC Genus Alternate 62.1 This study
BL-16S 920R 16S GAATTAAACCACATGCTCCACCGC Genus Alternate 61.0 This study
BL-HSP 71F groEL CTTATGTTGAAGGAATGCAATTTGA B. lonestari Alternate 55.6 This study
B. lonestari
This study
Rickettsia spp.
Rr.190 70P rompA ATGGCGAATATTTCTCCAAAA Genus Primary 52.5 (5)
Rr.190 602N rompA AGTGCAGCATTCGCTCCCCCT Genus Primary 64.9 (5)
BG1–21 rompB GGCAATTAATATCGCTGACGG Genus Alternate 55.6 (6)
BG2–20 rompB GCATCTGCACTAGCACTTTC Genus Alternate 55.2 (6)
RrCS 372 gltA TTTGTAGCTCTTCTCATCCTATGGC Genus Alternate 59.0 (7)
RrCS 989 gltA CCCAAGTTCCTTTAATACTTCTTTGC Genus Alternate 57.5 (7)
Primer 1 17kDa GCTCTTGCAACTTCTATGTT Genus Alternate 52.3 (8)
Primer 2
Ehrlichia spp.
ECB-R 16S CGTATTACCGCGGCTGCTGGCA Genus Alternate 65.6 (10)
ECAN-F 16S ATTTATAGCCTCTGGCTATAGGA E. canis Alternate 54.9 (11)
HE1-F 16S CAATTGCTTATAACCTTTTGGTTATAAAT E. chaffeensis Alternate 55.6 (12)
EE72-F 16S AATTCCTAAATAGTCTCTGACTATT E. ewingii Alternate 52.6 (11)

*TM, melting temperature, °C.

Main Article