Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 16, Number 3—March 2010

Dispatch

Influenza A Pandemic (H1N1) 2009 Virus Infection in Domestic Cat

Brett A. SponsellerComments to Author , Erin Strait, Albert Jergens, Jessie Trujillo, Karen Harmon, Leo Koster, Melinda Jenkins-Moore, Mary Killian, Sabrina Swenson, Holly Bender, Ken Waller, Kristina Miles, Tracy Pearce, Kyoung-Jin Yoon, and Peter Nara
Author affiliations: Iowa State University, Ames, Iowa, USA (B. A. Sponseller, E. Strait, A. Jergens, J. Trujillo, K. Harmon, H. Bender, K. Waller, K. Miles, T. Pearce, K.-Y. Yoon, P. Nara); US Department of Agriculture National Veterinary Services Laboratories, Ames (L. Koster, M. Jenkins-Moore, M. Killian, S. Swenson)

Main Article

Table 1

Oligonucleotide sequences for primers and probes and dye labels used in novel molecular testing for pandemic (H1N1) 2009 virus, Iowa State University Veterinary Diagnostic Laboratory, Ames, Iowa, USA, 2009*

Name Sequence (5′ → 3′) Description
Influenza A NP screening assay
SIVRTF CGGACGAAAAGGCAACGA NP forward primer
SIVRTR CTGCATTGTCTCCGAAGAAATAAG NP reverse primer
SIVRTP
CCGATCGTGCCYTC
NP probe, MGB FAM
Pandemic influenza M differentiation assay
M_F TCAGGCCCCCTCAAAGC M forward primer
M_R1 CATTCCATGAGAGCCTCAAGATC M reverse primer 1
M_R1a CACTCCATGAGAGCCTCAAGATC M reverse primer 2
M_R1b CATTCCATGAGTGCCTCAAGATC M reverse primer 3
M_EUPr CAGAGACTGGAAAGTGT EU M MGB, VIC
M_NAPr CAGAGACTYGAAGAYGT NA M MGB, FAM

*Primers and MGB probes were obtained from Integrated DNA Technologies (Coralville, IA, USA) and Applied Biosystems Inc. (Foster City, CA, USA), respectively. SIV, swine influenza virus; NP, nucleoprotein; M, matrix.

Main Article

TOP