Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 16, Number 4—April 2010


Contribution of Streptococcus anginosus to Infections Caused by Groups C and G Streptococci, Southern India

Silvana Reißmann, Claudia Friedrichs, Reena Rajkumari, Andreas Itzek, Marcus Fulde, Arne C. Rodloff, Kootallur N. Brahmadathan, Gursharan S. Chhatwal, and D. Patric Nitsche-SchmitzComments to Author 
Author affiliations: Helmholtz Centre for Infection Research, Braunschweig, Germany (S. Reißmann, A. Itzek, M. Fulde, G.S. Chhatwal, D.P. Nitsche-Schmitz); University Hospital Leipzig, Leipzig, Germany (C. Friedrichs, A.C. Rodloff); Christian Medical College, Vellore, Tamil Nadu, India (R. Rajkumari, K.N. Brahmadathan)

Main Article

Table 1

Sequences of primers used in study of groups C and G streptococci, Vellore, India, and Leipzig, Germany*

Name Sequence (5′ → 3′) Application
16S rDNA fwd AGAGTTTGATCCTGGCTC 16S rDNA amplification
16S rDNA rev
Primer 1 TATTCGCTTAGAAAATTAA emm amplification
Primer 2
M13 rev CAATTTCACACAGGAAACAGCTATGAC Sequencing of 1.1-kb fragment of moac
M13 fwd
moac1 CAAGGAATTGATTCAGCAACAGTGC Inverse PCR and sequencing of moac
moac-SP ATGAAAAAATCCATTCTAAATAAGGATATC Screening for 3,272-bp fragment of moac
moac-BamH1 GCGGATCCGGTCATTTTCCAAGCAAGG Screening for 962-bp fragment of moac

*moac, marker of Streptococcus anginosus and S. constellatus.

Main Article