Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 16, Number 4—April 2010

Research

Livestock-associated Methicillin-Resistant Staphylococcus aureus Sequence Type 398 in Humans, Canada

George R. Golding, Louis Bryden, Paul N. Levett, Ryan R. McDonald, Alice Wong, John Wylie, Morag R. Graham, Shaun Tyler, Gary Van Domselaar, Andrew E. Simor, Denise Gravel, and Michael R. MulveyComments to Author 
Author affiliations: National Microbiology Laboratory, Winnipeg, Manitoba, Canada (G.R. Golding, L. Bryden, M.R. Graham, S. Tyler, G. Van Domselaar, M.R. Mulvey); Saskatchewan Disease Control Laboratory, Regina, Saskatchewan, Canada (P.N. Levett, R.R. McDonald); Royal University Hospital, Saskatoon, Saskatchewan, Canada (A. Wong); Cadham Provincial Laboratories, Winnipeg (J. Wylie); Sunnybrook Health Sciences Centre, Toronto, Ontario, Canada (A.E. Simor); Public Health Agency of Canada, Ottawa, Ontario, Canada (D. Gravel)

Main Article

Table 4

Primers used for coverage of the novel SCCmecV subtype in methicillin-resistant Staphylococcus aureus isolates, Canada, 2007–2008*

Primer set Primer name Primer 5′ → 3′ Expected amplicon size, bp Reference position SCCmecV found in isolate
08 BA 02176 T 49209 07 BA 06477 08 BA 13895 08 BA 08100 08 BA 22334
1 OrfX
Adpr1 CATTTAAGATTATGCGTGGAG
CATCTGTAAACTGTCCTTTGG 347 443–789 + + + +
2 RibB2
MecaA1 TTGTATATGGGGAAACGAAG
TGCCAAAATCTCAGGTAAAG 3623 3793–7415 + + + +
3 MecB1
HypA1 CTTCACCATTATCGCTTTTAG
ACCATTTTTCCCTGGATTAC 1842 9172–11013 + + + + + +
4 Hyp3A1
Hyp1B1 CTTCCACGTATTGGTCTAGC
AAGTGAACGCGAAAGATATAG 2671 11636–14306 + + + + + +
5 Hyp3B1
CcrCA2 GCTAGACCAATACGTGGAAG
TTTTACCTGAAATGCCTGAG 3301 14287–17587 + + + + + +
6 CcrCB1
Hyp6A1 ATGAAATGGATAGCGAAATG
TTGAGTAAGTAGCGGTGTTG 1330 18695–20024 + + + + + +
7 Hyp6B1
Crspr1A1 TGAGCAAGTGATGGAAATG
CTTTGAATCCTTTGAAGACG 2835 20331–23165 + + + +
8 Crspr1B1
Crspr3A1 AAAAAGTGGTGAGGTTACTTG
CTCGTCTATCAATACCACTCG 711 23675–24385 + + + +
9 Crspr3B1
Crspr7A1 AACAGATGAACACGGAAAAG
TTGGTGGGTATCTCAAAAAG 2417 26166–28582 + + + +
10 Crspr7B1
Hyp11A1 GCCTTCTAACGTACCAGTTG
TTGCTTCAATGGACTATAAGC 1511 29289–30820 + + + +
11 Hyp11B1
Hyp12A1 TTAGGCATGGGGAAATATAG
GTCGCAATGTTTTGAAGTG 1622 31373– + + + +

*SCCmec, staphylococcal cassette chromosome mecV subtype; +, positive; –, negative. Testing by PCR.

Main Article

TOP