Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 16, Number 5—May 2010

Dispatch

La Crosse Virus in Aedes albopictus Mosquitoes, Texas, USA, 2009

Amy J. LambertComments to Author , Carol D. Blair, Mary D’Anton, Winnann Ewing, Michelle Harborth, Robyn Seiferth, Jeannie Xiang, and Robert S. Lanciotti
Author affiliations: Centers for Disease Control and Prevention, Fort Collins, Colorado, USA (A.J. Lambert, R.S. Lanciotti); Colorado State University, Fort Collins (C.D. Blair); Texas Department of State Health Services, Austin, Texas, USA (M. D’Anton, W. Ewing, M. Harborth, R. Seiferth, J. Xiang)

Main Article

Table

Orthobunyavirus consensus oligonucleotide primers used for amplification and sequencing of La Crosse virus partial S, M, and L segment cDNAs, Texas, 2009*

Targeted genomic regions Name Primer sequence (5′ → 3′) Approximate amplicon size, bp
S segment nucleocapsid ORF Cal S forward GCAAATGGATTTGATCCTGATGCAG 210

Cal S reverse
TTGTTCCTGTTTGCTGGAAAATGAT

M segment 5′ terminus/glycoprotein ORF Ortho M 5′ terminus AGTAGTGTACTACC 410

Ortho M ORF reverse
TTRAARCADGCATGGAA

L segment 5′ terminus/polymerase ORF Ortho L 5′ terminus AGTAGTGTACTCCTA 550
Ortho L ORF reverse AATTCYTCATCATCA

*Oligonucleotide primers designed against conserved regions of the orthobunyavirus genome. S segment primers appear in a previous publication (9). All primers were applied in singleplex reactions using methods described previously (9) with altered primer annealing conditions of 50oC for 1 min. S, small; M, medium; L, large; ORF, open reading frame.

Main Article

TOP