Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 16, Number 7—July 2010

Research

Population Structure of East African Relapsing Fever Borrelia spp.

Sally J. CutlerComments to Author , E. Margarita Bonilla, and Rajbir J. Singh
Author affiliations: University of East London, London, UK

Main Article

Table 1

Primer and probe sequences used in study of East African relapsing fever Borrelia spp.*

Primer specificity Primer/probe sequence, 5′ → 3′
Flagellin forward CTAGTGGGCATAGAATTAATCGTGC
Flagellin reverse GCTTGGGATAACCCTCTAATTTGA
Flagellin probe fam-TGGTATGGGTGTTGCTGGGAAAATTACG-bhq1
First-round IGS forward GTATGTTTAGTGAGGGGGGTG
First-round IGS reverse GGATCATAGCTCAGGTGGTTAG
Second-round IGS forward AGGGGGGTGAAGTCGTAACAAG
Second-round IGS reverse GTCTGATAAACCTGAGGTCGGA

*IGS, intragenic spacer.

Main Article

TOP